ID: 1180043839

View in Genome Browser
Species Human (GRCh38)
Location 21:45293845-45293867
Sequence CTTGGGATCAGCGCACCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180043839_1180043852 21 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043852 21:45293889-45293911 GGGGGAGGGGACCAGCGCCCCGG No data
1180043839_1180043846 2 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043846 21:45293870-45293892 AGCCACGTGTGGTCAGCATGGGG No data
1180043839_1180043841 -9 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043841 21:45293859-45293881 GATCCCAAGGAAGCCACGTGTGG No data
1180043839_1180043849 6 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043849 21:45293874-45293896 ACGTGTGGTCAGCATGGGGGAGG No data
1180043839_1180043850 7 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043850 21:45293875-45293897 CGTGTGGTCAGCATGGGGGAGGG No data
1180043839_1180043844 0 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043844 21:45293868-45293890 GAAGCCACGTGTGGTCAGCATGG No data
1180043839_1180043847 3 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043847 21:45293871-45293893 GCCACGTGTGGTCAGCATGGGGG No data
1180043839_1180043845 1 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043845 21:45293869-45293891 AAGCCACGTGTGGTCAGCATGGG No data
1180043839_1180043853 22 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043853 21:45293890-45293912 GGGGAGGGGACCAGCGCCCCGGG No data
1180043839_1180043851 8 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043851 21:45293876-45293898 GTGTGGTCAGCATGGGGGAGGGG No data
1180043839_1180043855 24 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043855 21:45293892-45293914 GGAGGGGACCAGCGCCCCGGGGG No data
1180043839_1180043854 23 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043854 21:45293891-45293913 GGGAGGGGACCAGCGCCCCGGGG No data
1180043839_1180043856 25 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180043839 Original CRISPR CTTGGGATCAGCGCACCCCC AGG (reversed) Intergenic
No off target data available for this crispr