ID: 1180043842

View in Genome Browser
Species Human (GRCh38)
Location 21:45293862-45293884
Sequence TGACCACACGTGGCTTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180043842_1180043850 -10 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043850 21:45293875-45293897 CGTGTGGTCAGCATGGGGGAGGG No data
1180043842_1180043851 -9 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043851 21:45293876-45293898 GTGTGGTCAGCATGGGGGAGGGG No data
1180043842_1180043854 6 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043854 21:45293891-45293913 GGGAGGGGACCAGCGCCCCGGGG No data
1180043842_1180043856 8 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG No data
1180043842_1180043852 4 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043852 21:45293889-45293911 GGGGGAGGGGACCAGCGCCCCGG No data
1180043842_1180043861 24 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043861 21:45293909-45293931 CGGGGGGCCTGCAGCACAGCAGG No data
1180043842_1180043862 25 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043862 21:45293910-45293932 GGGGGGCCTGCAGCACAGCAGGG No data
1180043842_1180043853 5 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043853 21:45293890-45293912 GGGGAGGGGACCAGCGCCCCGGG No data
1180043842_1180043855 7 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043855 21:45293892-45293914 GGAGGGGACCAGCGCCCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180043842 Original CRISPR TGACCACACGTGGCTTCCTT GGG (reversed) Intergenic