ID: 1180043848

View in Genome Browser
Species Human (GRCh38)
Location 21:45293872-45293894
Sequence TCCCCCATGCTGACCACACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180043848_1180043862 15 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043862 21:45293910-45293932 GGGGGGCCTGCAGCACAGCAGGG No data
1180043848_1180043865 29 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043865 21:45293924-45293946 ACAGCAGGGCCTGCCCTCCTGGG No data
1180043848_1180043861 14 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043861 21:45293909-45293931 CGGGGGGCCTGCAGCACAGCAGG No data
1180043848_1180043856 -2 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG No data
1180043848_1180043853 -5 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043853 21:45293890-45293912 GGGGAGGGGACCAGCGCCCCGGG No data
1180043848_1180043855 -3 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043855 21:45293892-45293914 GGAGGGGACCAGCGCCCCGGGGG No data
1180043848_1180043864 28 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043864 21:45293923-45293945 CACAGCAGGGCCTGCCCTCCTGG No data
1180043848_1180043854 -4 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043854 21:45293891-45293913 GGGAGGGGACCAGCGCCCCGGGG No data
1180043848_1180043852 -6 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043852 21:45293889-45293911 GGGGGAGGGGACCAGCGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180043848 Original CRISPR TCCCCCATGCTGACCACACG TGG (reversed) Intergenic
No off target data available for this crispr