ID: 1180043856

View in Genome Browser
Species Human (GRCh38)
Location 21:45293893-45293915
Sequence GAGGGGACCAGCGCCCCGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180043843_1180043856 7 Left 1180043843 21:45293863-45293885 CCAAGGAAGCCACGTGTGGTCAG No data
Right 1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG No data
1180043842_1180043856 8 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG No data
1180043839_1180043856 25 Left 1180043839 21:45293845-45293867 CCTGGGGGTGCGCTGATCCCAAG No data
Right 1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG No data
1180043848_1180043856 -2 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180043856 Original CRISPR GAGGGGACCAGCGCCCCGGG GGG Intergenic
No off target data available for this crispr