ID: 1180043862

View in Genome Browser
Species Human (GRCh38)
Location 21:45293910-45293932
Sequence GGGGGGCCTGCAGCACAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180043843_1180043862 24 Left 1180043843 21:45293863-45293885 CCAAGGAAGCCACGTGTGGTCAG No data
Right 1180043862 21:45293910-45293932 GGGGGGCCTGCAGCACAGCAGGG No data
1180043842_1180043862 25 Left 1180043842 21:45293862-45293884 CCCAAGGAAGCCACGTGTGGTCA No data
Right 1180043862 21:45293910-45293932 GGGGGGCCTGCAGCACAGCAGGG No data
1180043848_1180043862 15 Left 1180043848 21:45293872-45293894 CCACGTGTGGTCAGCATGGGGGA No data
Right 1180043862 21:45293910-45293932 GGGGGGCCTGCAGCACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180043862 Original CRISPR GGGGGGCCTGCAGCACAGCA GGG Intergenic
No off target data available for this crispr