ID: 1180048251

View in Genome Browser
Species Human (GRCh38)
Location 21:45319615-45319637
Sequence CTGGGGTTTCCCAGGGCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180048251_1180048257 -10 Left 1180048251 21:45319615-45319637 CCCGCAGCCCTGGGAAACCCCAG No data
Right 1180048257 21:45319628-45319650 GAAACCCCAGCCCAGTGGGCTGG No data
1180048251_1180048259 -6 Left 1180048251 21:45319615-45319637 CCCGCAGCCCTGGGAAACCCCAG No data
Right 1180048259 21:45319632-45319654 CCCCAGCCCAGTGGGCTGGCAGG No data
1180048251_1180048266 5 Left 1180048251 21:45319615-45319637 CCCGCAGCCCTGGGAAACCCCAG No data
Right 1180048266 21:45319643-45319665 TGGGCTGGCAGGAAGGAGGCCGG No data
1180048251_1180048265 1 Left 1180048251 21:45319615-45319637 CCCGCAGCCCTGGGAAACCCCAG No data
Right 1180048265 21:45319639-45319661 CCAGTGGGCTGGCAGGAAGGAGG No data
1180048251_1180048268 24 Left 1180048251 21:45319615-45319637 CCCGCAGCCCTGGGAAACCCCAG No data
Right 1180048268 21:45319662-45319684 CCGGTGTGCATGTGCCTGACTGG No data
1180048251_1180048262 -2 Left 1180048251 21:45319615-45319637 CCCGCAGCCCTGGGAAACCCCAG No data
Right 1180048262 21:45319636-45319658 AGCCCAGTGGGCTGGCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180048251 Original CRISPR CTGGGGTTTCCCAGGGCTGC GGG (reversed) Intergenic
No off target data available for this crispr