ID: 1180049308

View in Genome Browser
Species Human (GRCh38)
Location 21:45324120-45324142
Sequence CTGAGGGTTGGGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180049308_1180049330 23 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049330 21:45324166-45324188 CATGAGCTGAGCCTGCTGTGAGG No data
1180049308_1180049316 -7 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
1180049308_1180049333 28 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049308_1180049332 27 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049332 21:45324170-45324192 AGCTGAGCCTGCTGTGAGGAGGG No data
1180049308_1180049331 26 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049331 21:45324169-45324191 GAGCTGAGCCTGCTGTGAGGAGG No data
1180049308_1180049334 29 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049334 21:45324172-45324194 CTGAGCCTGCTGTGAGGAGGGGG No data
1180049308_1180049335 30 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049335 21:45324173-45324195 TGAGCCTGCTGTGAGGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180049308 Original CRISPR CTGAGGGTTGGGAGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr