ID: 1180049316

View in Genome Browser
Species Human (GRCh38)
Location 21:45324136-45324158
Sequence CCCTCAGCCTCCCCACCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180049302_1180049316 17 Left 1180049302 21:45324096-45324118 CCTAAAGAAGCCTCCTCCGCCTG No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
1180049303_1180049316 7 Left 1180049303 21:45324106-45324128 CCTCCTCCGCCTGCCCCTCCTCC No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
1180049309_1180049316 -8 Left 1180049309 21:45324121-45324143 CCTCCTCCCTCCCAACCCTCAGC No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
1180049305_1180049316 1 Left 1180049305 21:45324112-45324134 CCGCCTGCCCCTCCTCCCTCCCA No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
1180049308_1180049316 -7 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
1180049307_1180049316 -6 Left 1180049307 21:45324119-45324141 CCCCTCCTCCCTCCCAACCCTCA No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
1180049304_1180049316 4 Left 1180049304 21:45324109-45324131 CCTCCGCCTGCCCCTCCTCCCTC No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
1180049306_1180049316 -2 Left 1180049306 21:45324115-45324137 CCTGCCCCTCCTCCCTCCCAACC No data
Right 1180049316 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180049316 Original CRISPR CCCTCAGCCTCCCCACCCCC CGG Intergenic
No off target data available for this crispr