ID: 1180049333

View in Genome Browser
Species Human (GRCh38)
Location 21:45324171-45324193
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180049321_1180049333 0 Left 1180049321 21:45324148-45324170 CCACCCCCCGGCACCCACCATGA No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049322_1180049333 -3 Left 1180049322 21:45324151-45324173 CCCCCCGGCACCCACCATGAGCT No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049319_1180049333 2 Left 1180049319 21:45324146-45324168 CCCCACCCCCCGGCACCCACCAT No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049315_1180049333 12 Left 1180049315 21:45324136-45324158 CCCTCAGCCTCCCCACCCCCCGG No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049308_1180049333 28 Left 1180049308 21:45324120-45324142 CCCTCCTCCCTCCCAACCCTCAG No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049317_1180049333 11 Left 1180049317 21:45324137-45324159 CCTCAGCCTCCCCACCCCCCGGC No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049309_1180049333 27 Left 1180049309 21:45324121-45324143 CCTCCTCCCTCCCAACCCTCAGC No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049307_1180049333 29 Left 1180049307 21:45324119-45324141 CCCCTCCTCCCTCCCAACCCTCA No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049311_1180049333 21 Left 1180049311 21:45324127-45324149 CCCTCCCAACCCTCAGCCTCCCC No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049318_1180049333 5 Left 1180049318 21:45324143-45324165 CCTCCCCACCCCCCGGCACCCAC No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049310_1180049333 24 Left 1180049310 21:45324124-45324146 CCTCCCTCCCAACCCTCAGCCTC No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049323_1180049333 -4 Left 1180049323 21:45324152-45324174 CCCCCGGCACCCACCATGAGCTG No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049325_1180049333 -6 Left 1180049325 21:45324154-45324176 CCCGGCACCCACCATGAGCTGAG No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049326_1180049333 -7 Left 1180049326 21:45324155-45324177 CCGGCACCCACCATGAGCTGAGC No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049312_1180049333 20 Left 1180049312 21:45324128-45324150 CCTCCCAACCCTCAGCCTCCCCA No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049320_1180049333 1 Left 1180049320 21:45324147-45324169 CCCACCCCCCGGCACCCACCATG No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049324_1180049333 -5 Left 1180049324 21:45324153-45324175 CCCCGGCACCCACCATGAGCTGA No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049313_1180049333 17 Left 1180049313 21:45324131-45324153 CCCAACCCTCAGCCTCCCCACCC No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data
1180049314_1180049333 16 Left 1180049314 21:45324132-45324154 CCAACCCTCAGCCTCCCCACCCC No data
Right 1180049333 21:45324171-45324193 GCTGAGCCTGCTGTGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180049333 Original CRISPR GCTGAGCCTGCTGTGAGGAG GGG Intergenic
No off target data available for this crispr