ID: 1180054906

View in Genome Browser
Species Human (GRCh38)
Location 21:45352697-45352719
Sequence AGTCCCGAGGGCTCCTGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180054898_1180054906 -4 Left 1180054898 21:45352678-45352700 CCCAAAGACCCAGGCACCGAGTC No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054894_1180054906 5 Left 1180054894 21:45352669-45352691 CCTGTCCCTCCCAAAGACCCAGG No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054896_1180054906 0 Left 1180054896 21:45352674-45352696 CCCTCCCAAAGACCCAGGCACCG No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054889_1180054906 27 Left 1180054889 21:45352647-45352669 CCCAGGCCACGCTGTCCTGCTCC No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054899_1180054906 -5 Left 1180054899 21:45352679-45352701 CCAAAGACCCAGGCACCGAGTCC No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054890_1180054906 26 Left 1180054890 21:45352648-45352670 CCAGGCCACGCTGTCCTGCTCCC No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054892_1180054906 12 Left 1180054892 21:45352662-45352684 CCTGCTCCCTGTCCCTCCCAAAG No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054891_1180054906 21 Left 1180054891 21:45352653-45352675 CCACGCTGTCCTGCTCCCTGTCC No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054893_1180054906 6 Left 1180054893 21:45352668-45352690 CCCTGTCCCTCCCAAAGACCCAG No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data
1180054897_1180054906 -1 Left 1180054897 21:45352675-45352697 CCTCCCAAAGACCCAGGCACCGA No data
Right 1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180054906 Original CRISPR AGTCCCGAGGGCTCCTGCGG CGG Intergenic