ID: 1180055021

View in Genome Browser
Species Human (GRCh38)
Location 21:45353099-45353121
Sequence AATCCTACCCTGAGGCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180055021_1180055023 21 Left 1180055021 21:45353099-45353121 CCTGTCAGCCTCAGGGTAGGATT No data
Right 1180055023 21:45353143-45353165 ACACACAAACACACACACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180055021 Original CRISPR AATCCTACCCTGAGGCTGAC AGG (reversed) Intergenic
No off target data available for this crispr