ID: 1180055615

View in Genome Browser
Species Human (GRCh38)
Location 21:45357823-45357845
Sequence CCCTGAGAGTGCCCGGCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180055615_1180055626 30 Left 1180055615 21:45357823-45357845 CCACACGCCGGGCACTCTCAGGG No data
Right 1180055626 21:45357876-45357898 CTGGCCCCTGCCGCACCTGTGGG No data
1180055615_1180055625 29 Left 1180055615 21:45357823-45357845 CCACACGCCGGGCACTCTCAGGG No data
Right 1180055625 21:45357875-45357897 GCTGGCCCCTGCCGCACCTGTGG No data
1180055615_1180055623 -7 Left 1180055615 21:45357823-45357845 CCACACGCCGGGCACTCTCAGGG No data
Right 1180055623 21:45357839-45357861 CTCAGGGCACGGGGGGTGTCAGG No data
1180055615_1180055624 11 Left 1180055615 21:45357823-45357845 CCACACGCCGGGCACTCTCAGGG No data
Right 1180055624 21:45357857-45357879 TCAGGAGCAAGACAGCGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180055615 Original CRISPR CCCTGAGAGTGCCCGGCGTG TGG (reversed) Intergenic
No off target data available for this crispr