ID: 1180056100

View in Genome Browser
Species Human (GRCh38)
Location 21:45359948-45359970
Sequence TGCAGGTGGTCTTGGTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180056097_1180056100 -7 Left 1180056097 21:45359932-45359954 CCAGGCAGGGGGATCGTGCAGGT No data
Right 1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG No data
1180056085_1180056100 27 Left 1180056085 21:45359898-45359920 CCGAATTCATTATGTGGGAACTG No data
Right 1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG No data
1180056084_1180056100 28 Left 1180056084 21:45359897-45359919 CCCGAATTCATTATGTGGGAACT No data
Right 1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG No data
1180056083_1180056100 29 Left 1180056083 21:45359896-45359918 CCCCGAATTCATTATGTGGGAAC No data
Right 1180056100 21:45359948-45359970 TGCAGGTGGTCTTGGTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180056100 Original CRISPR TGCAGGTGGTCTTGGTGTCC AGG Intergenic
No off target data available for this crispr