ID: 1180057499

View in Genome Browser
Species Human (GRCh38)
Location 21:45366559-45366581
Sequence CCGCCCCGCCGCTGACCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180057499_1180057506 13 Left 1180057499 21:45366559-45366581 CCTCCGGGTCAGCGGCGGGGCGG No data
Right 1180057506 21:45366595-45366617 CTCGGCCCCTCTGAGATGCGAGG No data
1180057499_1180057510 25 Left 1180057499 21:45366559-45366581 CCTCCGGGTCAGCGGCGGGGCGG No data
Right 1180057510 21:45366607-45366629 GAGATGCGAGGTTGCAGTATTGG No data
1180057499_1180057505 -5 Left 1180057499 21:45366559-45366581 CCTCCGGGTCAGCGGCGGGGCGG No data
Right 1180057505 21:45366577-45366599 GGCGGGTGGTGGTGTGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180057499 Original CRISPR CCGCCCCGCCGCTGACCCGG AGG (reversed) Intergenic
No off target data available for this crispr