ID: 1180061959

View in Genome Browser
Species Human (GRCh38)
Location 21:45390244-45390266
Sequence CAGGTAACGAACTCGGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180061953_1180061959 9 Left 1180061953 21:45390212-45390234 CCTGCTGAGCACTCACCTCACCG No data
Right 1180061959 21:45390244-45390266 CAGGTAACGAACTCGGCCGCTGG No data
1180061952_1180061959 21 Left 1180061952 21:45390200-45390222 CCTGCGTCTCTTCCTGCTGAGCA No data
Right 1180061959 21:45390244-45390266 CAGGTAACGAACTCGGCCGCTGG No data
1180061955_1180061959 -6 Left 1180061955 21:45390227-45390249 CCTCACCGAAACCACAACAGGTA No data
Right 1180061959 21:45390244-45390266 CAGGTAACGAACTCGGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180061959 Original CRISPR CAGGTAACGAACTCGGCCGC TGG Intergenic
No off target data available for this crispr