ID: 1180063766

View in Genome Browser
Species Human (GRCh38)
Location 21:45402745-45402767
Sequence CCTGGCACGTCCGTCTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180063752_1180063766 8 Left 1180063752 21:45402714-45402736 CCCACACCTGTGCTCCAAGGCCC No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063745_1180063766 28 Left 1180063745 21:45402694-45402716 CCATGGCCACTCCCCTGCTCCCC No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063753_1180063766 7 Left 1180063753 21:45402715-45402737 CCACACCTGTGCTCCAAGGCCCC No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063758_1180063766 -6 Left 1180063758 21:45402728-45402750 CCAAGGCCCCCCAGGGACCTGGC No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063754_1180063766 2 Left 1180063754 21:45402720-45402742 CCTGTGCTCCAAGGCCCCCCAGG No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063749_1180063766 15 Left 1180063749 21:45402707-45402729 CCTGCTCCCCACACCTGTGCTCC No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063746_1180063766 22 Left 1180063746 21:45402700-45402722 CCACTCCCCTGCTCCCCACACCT No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063748_1180063766 16 Left 1180063748 21:45402706-45402728 CCCTGCTCCCCACACCTGTGCTC 0: 2
1: 5
2: 15
3: 51
4: 567
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063747_1180063766 17 Left 1180063747 21:45402705-45402727 CCCCTGCTCCCCACACCTGTGCT No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data
1180063751_1180063766 9 Left 1180063751 21:45402713-45402735 CCCCACACCTGTGCTCCAAGGCC No data
Right 1180063766 21:45402745-45402767 CCTGGCACGTCCGTCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180063766 Original CRISPR CCTGGCACGTCCGTCTCTTT GGG Intergenic
No off target data available for this crispr