ID: 1180064390

View in Genome Browser
Species Human (GRCh38)
Location 21:45405300-45405322
Sequence CGGGGGTCGCGGGGCTCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180064371_1180064390 29 Left 1180064371 21:45405248-45405270 CCGGGGCTGCGGGCAGGGGTTGG No data
Right 1180064390 21:45405300-45405322 CGGGGGTCGCGGGGCTCGGCCGG No data
1180064381_1180064390 0 Left 1180064381 21:45405277-45405299 CCAAGATGCGGCTGCGGGGGTCG No data
Right 1180064390 21:45405300-45405322 CGGGGGTCGCGGGGCTCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180064390 Original CRISPR CGGGGGTCGCGGGGCTCGGC CGG Intronic