ID: 1180064434

View in Genome Browser
Species Human (GRCh38)
Location 21:45405445-45405467
Sequence CGGGGTCCGCGCGGCCTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 211}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180064430_1180064434 -7 Left 1180064430 21:45405429-45405451 CCCTGGTCCTGCTGCTCGGGGTC 0: 1
1: 0
2: 1
3: 37
4: 195
Right 1180064434 21:45405445-45405467 CGGGGTCCGCGCGGCCTCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 211
1180064424_1180064434 10 Left 1180064424 21:45405412-45405434 CCTGGACGTGCTCGCGCCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1180064434 21:45405445-45405467 CGGGGTCCGCGCGGCCTCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 211
1180064429_1180064434 -6 Left 1180064429 21:45405428-45405450 CCCCTGGTCCTGCTGCTCGGGGT 0: 1
1: 0
2: 3
3: 27
4: 194
Right 1180064434 21:45405445-45405467 CGGGGTCCGCGCGGCCTCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 211
1180064431_1180064434 -8 Left 1180064431 21:45405430-45405452 CCTGGTCCTGCTGCTCGGGGTCC 0: 1
1: 0
2: 5
3: 24
4: 273
Right 1180064434 21:45405445-45405467 CGGGGTCCGCGCGGCCTCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 211
1180064423_1180064434 13 Left 1180064423 21:45405409-45405431 CCTCCTGGACGTGCTCGCGCCCC 0: 1
1: 0
2: 0
3: 6
4: 99
Right 1180064434 21:45405445-45405467 CGGGGTCCGCGCGGCCTCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 211
1180064422_1180064434 27 Left 1180064422 21:45405395-45405417 CCGCGGCGGCGGCGCCTCCTGGA 0: 1
1: 0
2: 0
3: 24
4: 158
Right 1180064434 21:45405445-45405467 CGGGGTCCGCGCGGCCTCCGCGG 0: 1
1: 0
2: 1
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180064434 Original CRISPR CGGGGTCCGCGCGGCCTCCG CGG Intronic
900101645 1:964584-964606 AGGGGTCCGCGCGTCCGCAGTGG + Intronic
900146974 1:1162690-1162712 CGGAGTCTGCGGGGCCTGCGGGG + Intergenic
900241912 1:1621259-1621281 CTGGCTCCGCGGGGCCTCCGAGG + Intronic
900513340 1:3070333-3070355 CGGGGTGCGCGCGGGCTGCTCGG - Intronic
900562358 1:3313617-3313639 CGGGGTCCGCACGGCCTCGCAGG - Intronic
901049539 1:6419496-6419518 GGGGTTCCGCGCGGCGCCCGAGG - Intronic
901577310 1:10210963-10210985 CGGGGTCCGGGCGGGGTCTGAGG + Intronic
901738106 1:11325115-11325137 CGGGGTCCTCGCTCCCTCCCTGG - Intergenic
903016784 1:20366670-20366692 CGGCGTCCGCGGGGCGTGCGCGG - Intergenic
904160430 1:28518632-28518654 CCGGGTGCGCGCGGCCGCCCGGG + Intronic
905066837 1:35192075-35192097 CGGGGGCGGGGCGGCCTGCGGGG - Intronic
905682348 1:39883261-39883283 GGGTGTCCACGCGGCCTCCGGGG + Intronic
906315517 1:44784402-44784424 CGGGGTCTGCGCGGCGGGCGCGG + Exonic
907136263 1:52142186-52142208 CGGGATCCGCGTGGCTGCCGCGG + Exonic
908356799 1:63330203-63330225 CTGGGTCCTCTCGGCCTCCCAGG - Intergenic
910251375 1:85201520-85201542 CGGGGTCCCCGCGGCACCGGGGG - Intergenic
913186434 1:116373791-116373813 CCCGGCCCGCTCGGCCTCCGGGG - Intronic
915740257 1:158113692-158113714 CGGGCTCCGGGCGGCCGCCGGGG - Intergenic
916651580 1:166839356-166839378 CGGCGCCCGCGCGAGCTCCGGGG - Intergenic
918332516 1:183472961-183472983 CGGGGTCGCCGCCGCCTCCCCGG - Intronic
1063623108 10:7667020-7667042 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623136 10:7667078-7667100 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623150 10:7667107-7667129 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623175 10:7667165-7667187 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623189 10:7667194-7667216 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1063623216 10:7667251-7667273 CGGGGTCCGGGCTGGGTCCGTGG - Intergenic
1067216942 10:44311053-44311075 CGGGGTCTGCGCGGCTGCGGTGG + Intergenic
1071527665 10:86367323-86367345 CGAGGTCCGCGCGGCCAGCCAGG - Intergenic
1072970124 10:100009996-100010018 CGCGGTCCGCGCGGCCCCGGGGG + Intergenic
1073123132 10:101133914-101133936 CGGGGCCAGGGAGGCCTCCGTGG + Intronic
1075032126 10:119030380-119030402 CCGGCTGCACGCGGCCTCCGGGG + Exonic
1076156806 10:128210980-128211002 CGGTGCCCGCGCGGCCTCCAGGG + Intergenic
1076864484 10:133160260-133160282 CGGGGTGCGCGGGGGCTGCGCGG - Intergenic
1077017474 11:403361-403383 CAGGGTCCGCGGAGCCTCGGAGG + Intronic
1077056754 11:597665-597687 TGGGGTCCGCCCGGCCCCGGTGG + Intronic
1077322182 11:1947440-1947462 CGGAGTCCGCGCGCCCTGTGGGG - Intronic
1077386017 11:2269858-2269880 CGGGCTCCGAGCTGCCCCCGCGG + Exonic
1077898835 11:6474031-6474053 CGGGGTGGGCGGGGCCTCCGCGG - Intronic
1081502561 11:43680863-43680885 CTGGGTCGGCGCGGGCACCGTGG + Exonic
1082044732 11:47715439-47715461 CGGGGTCCCCGCTCCCTCCTTGG - Intergenic
1083927606 11:65818037-65818059 CGGGAGCCGCGCGGCCGGCGCGG - Intergenic
1084146114 11:67266321-67266343 CAGATTCCGCGCGGCCTCCAGGG + Intergenic
1090375142 11:126283100-126283122 CGCGGACTGCGCGGGCTCCGCGG - Exonic
1090758442 11:129815521-129815543 CAGGGTCCTCGCCGCCTCCCAGG + Intergenic
1202805200 11_KI270721v1_random:2753-2775 CGGAGTCCGCGCGCCCTGTGGGG - Intergenic
1092487469 12:8914724-8914746 GGGGGCTCGCTCGGCCTCCGCGG - Exonic
1095958663 12:47820132-47820154 CGGGTTCGGCGCTGCCTCCCCGG - Intronic
1095982889 12:47982873-47982895 CAGGGTCCCCGTGGCCTCCCCGG - Exonic
1096782764 12:54000557-54000579 CGCAGTCCGCGCGGCGCCCGGGG - Exonic
1096946703 12:55414917-55414939 GGGGGCTCGCTCGGCCTCCGCGG + Intergenic
1097193199 12:57230073-57230095 CCGGGTCCGCGGGGCATCCGGGG - Intronic
1097195212 12:57239225-57239247 TGGGGGCCGCTCGGCCTCCAGGG - Intronic
1103377730 12:120469680-120469702 CAGCGTCCCCGCGGGCTCCGAGG + Exonic
1103404665 12:120666894-120666916 AGGGGCCCTCGCGGCCTCAGCGG - Exonic
1104645512 12:130494693-130494715 CAGGGTCCTGGAGGCCTCCGTGG - Intronic
1104757817 12:131279761-131279783 TGGGGTCAGAGCAGCCTCCGTGG - Intergenic
1111096051 13:83516991-83517013 CGGGGTGGGCGCAGGCTCCGAGG + Intergenic
1113379059 13:109786480-109786502 CGGGGTCCGCGCCGCCGCCGGGG + Exonic
1114224202 14:20723466-20723488 CGGGGGCTCCCCGGCCTCCGCGG + Intergenic
1115320872 14:32077552-32077574 CTGGGGCCCCGCGGCCGCCGAGG + Intronic
1117289233 14:54316360-54316382 CAGGGACCACGAGGCCTCCGGGG - Intergenic
1117920790 14:60723760-60723782 CGGGGTCTGCGCGGCGGCGGCGG + Exonic
1121050388 14:90816122-90816144 GGGGGGCGCCGCGGCCTCCGCGG - Intronic
1122220711 14:100238108-100238130 CGGGGTCGGCGCGAGCTCGGCGG - Intergenic
1122975470 14:105168968-105168990 CGGGGTCAGCGCGGGCCGCGGGG + Intergenic
1122999279 14:105283491-105283513 TGGGGTCCACGGGGCCTCCTGGG + Intronic
1123024974 14:105420147-105420169 CGGGGGGCGCGGGGCCTGCGGGG - Intronic
1126436824 15:48645530-48645552 CGGGGGTCGGGCGGCCACCGGGG - Intronic
1130002465 15:80059585-80059607 CGGGGCCCGCGCGTCAGCCGCGG + Exonic
1132946103 16:2532225-2532247 GGGGGTCCGCGGGCCCGCCGGGG - Intergenic
1133156559 16:3880444-3880466 CGGGGTCGCCGCCGCCGCCGCGG + Exonic
1136500782 16:30668892-30668914 TGGAGTCCGGGCGGCCTCAGGGG - Exonic
1136573093 16:31108509-31108531 CGTGCGCCGCGGGGCCTCCGCGG - Intronic
1136628845 16:31477600-31477622 CCGGGAGGGCGCGGCCTCCGGGG - Exonic
1137288795 16:47037787-47037809 CGCGGTCCTCGCGGCCTCCCCGG - Intergenic
1137426397 16:48384883-48384905 CGGGGGCCGGGCCGCCGCCGAGG + Intronic
1139364826 16:66427039-66427061 CGGGAGCCGCGCCGCCGCCGAGG + Intergenic
1141418920 16:83899199-83899221 CGGGGCCCGGGCGGCCGCGGGGG - Exonic
1141430615 16:83968786-83968808 CGGGGTCCGCGGGGGCGGCGGGG - Exonic
1141839771 16:86567185-86567207 CGGGCTCCTGGCAGCCTCCGGGG - Intergenic
1142130725 16:88430473-88430495 CGGGGTCTGCGCGGCTCCCGGGG - Exonic
1142403498 16:89873441-89873463 CGGCGTCTGGGCGGGCTCCGGGG - Intergenic
1143063357 17:4222215-4222237 CGGGGTCCGCGGGGCGGCGGGGG - Intronic
1143150837 17:4807078-4807100 CGGGGGCCGCCCCGCCCCCGAGG + Exonic
1144565111 17:16353352-16353374 CGCGGCCCCCGCGGCCTCCGCGG - Exonic
1144565114 17:16353361-16353383 CGGGGCCTCCGCGGCCCCCGCGG - Exonic
1144873198 17:18382906-18382928 CAGGGTCCGGGCGGCCACCCAGG - Intronic
1146167374 17:30600595-30600617 CCGTCTCCTCGCGGCCTCCGCGG - Intergenic
1147919460 17:43907169-43907191 CGGTATCTGCGCGGCCTCCCCGG - Intronic
1148225186 17:45894440-45894462 GGCGGGCAGCGCGGCCTCCGCGG - Exonic
1148664056 17:49361808-49361830 CGGGGCCGGCCCGGGCTCCGGGG - Intronic
1148936340 17:51166754-51166776 CGGCGCCCACGTGGCCTCCGCGG + Exonic
1150488736 17:65560789-65560811 CGCGGTCCGCCCGGCCGCCTCGG + Intronic
1151748043 17:76022125-76022147 CAGGGTCCGGGCGGCCACCCAGG + Intronic
1151823871 17:76512779-76512801 CGGGCTCCCCACGGCCTCCCCGG - Intergenic
1152633420 17:81420757-81420779 CGGTGTCAGCGGGGCCACCGAGG - Intronic
1152782235 17:82231513-82231535 CGGGGTCCAGGAGGCCTCGGAGG + Intronic
1152878492 17:82801977-82801999 CGGGGTCAGCTCAGCCTCCCTGG + Intronic
1154416673 18:14179078-14179100 CGGGACCCGGGCGGCCACCGCGG + Intergenic
1159346723 18:67215825-67215847 CCGGGTGGGCGCGGGCTCCGTGG - Intergenic
1160100600 18:75916570-75916592 CGCGGTGGGCGCGGCCTGCGGGG + Intergenic
1160566078 18:79787515-79787537 CGTGGTGCGCGCGGCCACTGGGG - Intergenic
1160707988 19:538796-538818 CGGGCCCCGTGCGGCCTCCTGGG + Intronic
1160856053 19:1218516-1218538 TTGGGACCGCGGGGCCTCCGTGG + Intronic
1160858938 19:1229508-1229530 CCGGGGCCGCGCGGGCGCCGGGG + Exonic
1161029461 19:2051015-2051037 CGGGGGCGGCGAGGGCTCCGCGG + Intronic
1161099733 19:2415716-2415738 CGGGTTCGGAGCTGCCTCCGGGG + Exonic
1161102272 19:2427091-2427113 CGGGGTCAGGGCGGTCCCCGGGG - Intronic
1161510795 19:4670062-4670084 CGCGGTCCGCGCCCCCTCCTCGG + Intronic
1161961690 19:7526865-7526887 CCGGGTCCACGTGGCCTCGGTGG - Exonic
1162128244 19:8510881-8510903 CGGCGCCCCCGCGGCCCCCGCGG - Exonic
1162128247 19:8510884-8510906 CGGGGGCCGCGGGGGCGCCGGGG + Exonic
1163548378 19:17952162-17952184 CGGGGTCCGCGCCCCCTCCCCGG + Intronic
1163678778 19:18668933-18668955 CGTGGTCCATGCGGCCCCCGAGG - Exonic
1164995775 19:32719884-32719906 CGGGGTCCGCGAGGGCTCCTGGG + Intronic
1165080415 19:33303166-33303188 CGGGGTCCTAGCGCCCTGCGCGG - Intergenic
1165879558 19:39032465-39032487 CGGTGTCGGTGCGGCCGCCGAGG - Intronic
1166765671 19:45251316-45251338 CCGGCTCCGCGCCCCCTCCGCGG + Exonic
1167297732 19:48661765-48661787 CGGGCCCAGCGCGGCCTCCATGG + Exonic
1167309587 19:48729264-48729286 CGGGGCCTGCGAGGCCGCCGTGG - Exonic
1167501353 19:49850659-49850681 CGGGCCCCGCGCGGCCTGGGCGG - Intergenic
1167648993 19:50719514-50719536 CCGGGCCCGCTCGCCCTCCGGGG - Intergenic
1168154514 19:54465335-54465357 CGGGGAGCGCGGGGCCCCCGCGG + Exonic
926320752 2:11746873-11746895 CGAGGCCCTCCCGGCCTCCGGGG - Intronic
927713970 2:25341266-25341288 CGGGCCCCGCGCAGGCTCCGCGG - Intronic
927714281 2:25342105-25342127 CGGGGCCAGCGCGGCCGCGGGGG - Intronic
934566897 2:95346366-95346388 CGCCGACCGCGCGGCCTCCAGGG + Intronic
935275833 2:101474503-101474525 CGGGGTCCGCGCATCCTCGGCGG - Intronic
937716313 2:125037435-125037457 CAGGGTGGGCGCGGGCTCCGGGG + Intergenic
937984651 2:127633075-127633097 CTGGCTCCACGCGGCCTCAGAGG - Intronic
938177200 2:129144544-129144566 CCGGGTGGGCGCGGGCTCCGCGG - Intergenic
938296397 2:130182136-130182158 CGGGGACGGGGCCGCCTCCGCGG - Exonic
938296462 2:130182311-130182333 CGGGGTCGGCGGCGCCCCCGGGG + Exonic
938322119 2:130372565-130372587 TGGGGTCCCCGCGGCCGCCAGGG - Intronic
938460289 2:131492326-131492348 CGGGGTCGGCGGCGCCCCCGGGG - Exonic
942116782 2:172735888-172735910 CGGGGTCCGCGCGGCGGACGAGG + Exonic
942444335 2:176068043-176068065 AGGGGTCCGCGCGGTTTCTGGGG - Intergenic
943182439 2:184560896-184560918 CGGGGTTCCCGCTGGCTCCGTGG + Intergenic
947765233 2:232633583-232633605 CCGGGTCCCCGCCGCCTCGGCGG + Exonic
948369045 2:237475647-237475669 GGGGGTCCGCGCTGCCTGCCCGG + Intergenic
948823172 2:240560556-240560578 CCGGGTCCTAGAGGCCTCCGAGG - Exonic
1168883430 20:1226152-1226174 CGGGGTCCGGCCGGCCTCTCAGG - Exonic
1169065480 20:2692613-2692635 CAGGGTCCGCCCCGCCGCCGCGG + Intergenic
1169664525 20:8019512-8019534 CGGCGGCAGCGCGGCCTCCTCGG + Exonic
1170999279 20:21396857-21396879 CGGGGTGCGCGCGGCTTAGGAGG - Intronic
1172015442 20:31870286-31870308 CGGGCCCCGCGCAGCCTCCCCGG - Intronic
1175267173 20:57709856-57709878 CGGGGCGCGCGCTGCCGCCGGGG + Exonic
1176856662 21:13980182-13980204 CGGGAGCCGGGCGGCCACCGCGG - Intergenic
1178843729 21:36157288-36157310 CGCGGCCCGCGCGCCCTCCCGGG + Intronic
1180064434 21:45405445-45405467 CGGGGTCCGCGCGGCCTCCGCGG + Intronic
1181265853 22:21630075-21630097 CGGGGCCCGGGCAGCGTCCGGGG - Intergenic
1181964191 22:26645246-26645268 CAGGCTCCTCGCGGCCTCCCTGG - Intergenic
1184676218 22:46044866-46044888 CGAGGTCCGGGTGGCCGCCGCGG - Intergenic
1184680711 22:46071121-46071143 CGGGGCCCGCGCGGCCGAGGCGG - Intronic
1185342860 22:50299432-50299454 CGGGGCCTCCGGGGCCTCCGTGG - Intronic
950902804 3:16512974-16512996 CGGGGTGCGCGCGGCCTGGGTGG - Intronic
951527988 3:23672011-23672033 CGGGGCGGGCGCGGCCTCCTGGG - Intergenic
952316734 3:32238596-32238618 GGGCGTCCGCGGCGCCTCCGCGG + Intergenic
954397809 3:50302358-50302380 CTGCGTCCTCGCGGCCTCTGGGG - Exonic
954409789 3:50365457-50365479 GGGGCTCCCCTCGGCCTCCGCGG + Exonic
955996950 3:64687740-64687762 CGGGCTCCGCGCGCTCTCCACGG - Exonic
958638521 3:96776809-96776831 CGGGGTCTCCGCGGCGTGCGCGG - Intergenic
961674272 3:128555381-128555403 CAGGGTGCGCGCGGCGGCCGCGG + Intergenic
964041633 3:152268638-152268660 CGGAGCCCGCGCGGGCGCCGTGG - Exonic
966861509 3:184233361-184233383 CGGGGCCCCCCAGGCCTCCGGGG + Exonic
967141760 3:186567398-186567420 CGGGGTCCGCCAGGTCTCGGTGG - Exonic
968051456 3:195657885-195657907 CGGGGAGCGCGGGACCTCCGTGG + Intergenic
968104363 3:195990448-195990470 CGGGGAGCGCGGGACCTCCGTGG - Intergenic
968148261 3:196317927-196317949 CGGGGGACGCGCGGGGTCCGCGG - Intronic
968302661 3:197628038-197628060 CGGGGAGCGCGGGACCTCCGTGG - Intergenic
968433792 4:575108-575130 CGGGGACTGCGCGGGCTTCGCGG - Intergenic
968579295 4:1382476-1382498 CTGGGACCGCGCGGCCTTCCTGG - Intronic
968701410 4:2059711-2059733 CGGGGGGCGCGGGGCCGCCGGGG + Exonic
968701464 4:2059946-2059968 CGGGGTCCGCGTGGACGCCGGGG - Intronic
968803194 4:2756303-2756325 CGGCGGCCGCGCGGCCTCCCGGG - Exonic
969115297 4:4867350-4867372 TGGAGGCCGCGCGGCCTCGGGGG - Intergenic
969115301 4:4867353-4867375 CCGAGGCCGCGCGGCCTCCAAGG + Intergenic
969714406 4:8861344-8861366 CGCGGGAAGCGCGGCCTCCGGGG - Intronic
975778960 4:77819605-77819627 CGGGGTCCGGGCGGCGGCGGCGG + Intronic
980053792 4:128061527-128061549 CGGGCGCTGCGCGGCCTCGGCGG + Intronic
983229130 4:165112479-165112501 CGGTGGGCGCGCGGCCCCCGGGG - Intronic
985520961 5:373758-373780 CGGGGTCCGCGCGGGCGCTCCGG - Intronic
985784533 5:1886970-1886992 GAGGCTCCGCGCGGCCGCCGAGG - Exonic
987050614 5:14144276-14144298 CTCAGTCCGCTCGGCCTCCGGGG - Intronic
989523103 5:42423843-42423865 CGGGGTCCCCGCCGCCGCCCGGG - Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
992269930 5:75053541-75053563 CGGGGTCCGTGCGGCTGCGGAGG + Intergenic
997265019 5:132490404-132490426 GGGCCTCCGCGCGGGCTCCGGGG - Intronic
1003139049 6:3456427-3456449 CGGGGCCCGCGCGTCCCCCGAGG + Exonic
1003624367 6:7728197-7728219 CGGGATCCGAGCGCCTTCCGCGG - Intronic
1004044722 6:12012564-12012586 CAGGTTCGGCGCGGGCTCCGCGG + Exonic
1004396203 6:15248382-15248404 CGGGGGTGGCGCGGCCTGCGGGG + Intronic
1005526793 6:26659422-26659444 CAGGGTAAGCGCGGCCTGCGGGG - Exonic
1006296927 6:33173898-33173920 CGGGGTCAGCGGGGACCCCGAGG - Exonic
1006296928 6:33173901-33173923 CGGGGTCCCCGCTGACCCCGTGG + Exonic
1008545223 6:52577434-52577456 CGGGGCGCTCGCTGCCTCCGGGG - Intergenic
1008932471 6:56954941-56954963 CGGGGCCCGGGCGGCCGCGGCGG - Intergenic
1013793618 6:113860195-113860217 CGAGGCGGGCGCGGCCTCCGGGG + Exonic
1014798369 6:125749856-125749878 CGGGGTGAGCGCGGGCTCCGCGG + Exonic
1017470419 6:154733314-154733336 TGGTTTCCGCGCGGCCGCCGGGG + Intronic
1017688772 6:156942442-156942464 TGGGGTCCACGCTGCCTCTGTGG - Intronic
1018400649 6:163415659-163415681 CGGGGGCTGCGCGGACTCGGTGG + Intronic
1019344237 7:521706-521728 GGGGGTCCTCGCCGCCTCTGAGG + Intergenic
1019474175 7:1236163-1236185 CGCGGTCCCCGCGGCGCCCGAGG - Exonic
1019689622 7:2403489-2403511 CGGGCGCCCCTCGGCCTCCGTGG + Intergenic
1019731564 7:2632115-2632137 CCGGATGCGCGCGGCCTGCGCGG - Exonic
1022427953 7:30285551-30285573 CGGGGCCGCCGCGGCCGCCGCGG - Exonic
1023629430 7:42148873-42148895 CTGGGGACGCGGGGCCTCCGGGG + Intronic
1023866199 7:44239466-44239488 CGGGGGCCTGGCGGCCTCTGGGG + Intronic
1026000473 7:66556719-66556741 CTGGGTCCGCTCTGGCTCCGCGG - Intergenic
1029461023 7:100694020-100694042 CGGGCTCGGCGCGGCCGCCGCGG + Intergenic
1030049041 7:105522020-105522042 CGGCCTCCCCGCGGCCGCCGGGG - Intronic
1032298796 7:130668390-130668412 CGGGGCGCGCGCGGGCGCCGGGG + Intronic
1032781880 7:135170453-135170475 CGGGGTCAGCGAGGCCCCTGCGG - Intronic
1035033805 7:155882232-155882254 CAGGGCCCGCGTGGCCGCCGTGG - Intergenic
1035683595 8:1507452-1507474 CTGGGTGGGCGCGGGCTCCGCGG - Intronic
1037547732 8:19940064-19940086 CGGGGTACGCTCGCCCTCGGCGG + Intronic
1037844992 8:22275349-22275371 CCAGCTCCGCGCGGCCTCAGGGG - Exonic
1040564908 8:48556410-48556432 CGGCGCCCGGGCCGCCTCCGCGG + Intergenic
1042224595 8:66505428-66505450 CAGGGTCCCTGCGGTCTCCGCGG - Exonic
1045222513 8:100213015-100213037 CGCGGCCTCCGCGGCCTCCGCGG + Intronic
1049644005 8:143728008-143728030 CGGGGGCCGCGCGGGTTTCGCGG - Exonic
1052896167 9:33750350-33750372 CGGGCTCCTCGCCGCCTCCCAGG + Intergenic
1053003395 9:34589958-34589980 CGCGGTCCGCTCGCCCTGCGCGG + Intronic
1054798641 9:69325427-69325449 CGGGGCCAGCGCGGCCGCAGCGG - Intronic
1057208130 9:93185196-93185218 CGGGGGCGGCGGGGCGTCCGCGG - Exonic
1057208148 9:93185250-93185272 CGGCGTCCGCGGGGGCTCCGGGG - Exonic
1057619018 9:96619123-96619145 CGGGCTGCCCGGGGCCTCCGGGG - Intronic
1060192122 9:121599816-121599838 CGGGATCCGAGCGGCATCCCGGG + Intronic
1060269047 9:122128367-122128389 CGGGTTGCGGGAGGCCTCCGTGG - Intergenic
1062547401 9:137069927-137069949 CTGGGACCGCTCGGGCTCCGCGG + Exonic
1062646869 9:137552154-137552176 CGGGGCCCGCGCAGCTTCAGGGG + Exonic
1189418242 X:40833145-40833167 CGGCGGCCGTGCGGCCTCCCAGG - Intergenic
1191250009 X:58255778-58255800 CGGGGTCCCCGAGACCCCCGTGG - Intergenic
1194977369 X:100408814-100408836 CGGGGGCCCCGGGGGCTCCGAGG + Exonic
1200092914 X:153644222-153644244 CGGCGTCCCCGCGGCCTCCAGGG + Intronic