ID: 1180064969

View in Genome Browser
Species Human (GRCh38)
Location 21:45407763-45407785
Sequence GGGGCAGGACATGCATCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180064969_1180064977 10 Left 1180064969 21:45407763-45407785 CCAGAAGATGCATGTCCTGCCCC 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1180064977 21:45407796-45407818 TAGGACCTCCTCCTGTCTGGTGG 0: 1
1: 0
2: 0
3: 10
4: 256
1180064969_1180064976 7 Left 1180064969 21:45407763-45407785 CCAGAAGATGCATGTCCTGCCCC 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1180064976 21:45407793-45407815 CACTAGGACCTCCTCCTGTCTGG 0: 1
1: 0
2: 2
3: 24
4: 620
1180064969_1180064970 -9 Left 1180064969 21:45407763-45407785 CCAGAAGATGCATGTCCTGCCCC 0: 1
1: 0
2: 0
3: 7
4: 154
Right 1180064970 21:45407777-45407799 TCCTGCCCCTGCTCACCACTAGG 0: 1
1: 0
2: 1
3: 39
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180064969 Original CRISPR GGGGCAGGACATGCATCTTC TGG (reversed) Intronic
900411046 1:2512831-2512853 GGGGCAGGACAGGCACCCACAGG + Intronic
900882509 1:5392298-5392320 GGGGCACATCTTGCATCTTCGGG - Intergenic
902938278 1:19780536-19780558 TGGGAAGGTCATGCTTCTTCAGG - Intronic
904567347 1:31435634-31435656 GAGGCAGGACAGGCATCTGGAGG + Intergenic
904713523 1:32449329-32449351 GGGGCGGGGCATGCCTCCTCAGG + Intergenic
905309196 1:37037751-37037773 GTGGCATGACATGCCTCTCCAGG + Intergenic
907398622 1:54210169-54210191 GGAGAAGGACATGCTTTTTCTGG + Intronic
908130845 1:61074090-61074112 GGGGCAGGGCATTCCTCTCCAGG - Intronic
909521786 1:76576885-76576907 GGGGCAGGACATGTATGTGGTGG - Intronic
913045384 1:115069432-115069454 GGGGCATTACATGCATCTGTTGG + Intronic
915030890 1:152879670-152879692 GGGGCAGGACCTGCATCCATGGG + Intronic
919300824 1:195763400-195763422 GCGGCAGGGCATGCAGCTCCAGG - Intergenic
920570241 1:207010875-207010897 GGGGCAGAAAAGGCATGTTCTGG - Intronic
922612838 1:226942640-226942662 GGGGCTGGGCCTGCATCTTCAGG + Intronic
1063626661 10:7696667-7696689 GGGCCAGGACAAGCTTCTCCTGG - Intergenic
1064322125 10:14315230-14315252 TGGGCTGGACATACATATTCAGG - Intronic
1067272397 10:44803692-44803714 GGGCCAAGTCCTGCATCTTCTGG - Intergenic
1069043862 10:63722435-63722457 GTAGCAAGACATGCATCATCTGG - Intergenic
1071089258 10:81899694-81899716 GGGCCAGGCCCTTCATCTTCAGG - Intronic
1071974354 10:90940042-90940064 GGGGCTGGAGTTGGATCTTCTGG + Intergenic
1072954969 10:99880130-99880152 GGCGGAGGAGATGCATCTTGAGG + Exonic
1074116221 10:110459228-110459250 GGGGAAGGACATGAATGTTGGGG - Intergenic
1074858413 10:117490752-117490774 GGGTCCTGGCATGCATCTTCTGG + Intergenic
1075311235 10:121415452-121415474 GGTGCAGGGCATACAGCTTCTGG - Intergenic
1075896924 10:126004459-126004481 GGGGCAGGGGATGAATATTCTGG - Intronic
1078145399 11:8718823-8718845 GGGGCAGGAGATACAGCTTGTGG - Intronic
1084038702 11:66529470-66529492 GTGGCAGGACATGGATTGTCTGG + Intronic
1084964878 11:72739309-72739331 GGGCCAGGACAGGAATCTCCTGG - Intronic
1086866429 11:91985519-91985541 TGTGCTGGACATCCATCTTCAGG + Intergenic
1089419443 11:118320119-118320141 GGGGAAGGACATGCAGGTTGAGG - Intergenic
1091314618 11:134604754-134604776 GGTGGAGCACAGGCATCTTCAGG - Intergenic
1091968856 12:4769122-4769144 GGAGAAGGTCATCCATCTTCGGG + Intronic
1100120523 12:91364338-91364360 GGGGCAGGACATGCAGGGTTAGG + Intergenic
1100263797 12:92957037-92957059 GGGGCATGACATTGATATTCTGG - Intergenic
1109369000 13:61397142-61397164 GGGGCAGAGCATGCCTGTTCAGG + Intergenic
1113289491 13:108889211-108889233 TGGGCAGGCCATGCACCTTTGGG + Intronic
1117581329 14:57154311-57154333 GGAGCAGGACATGAATTTTGTGG + Intergenic
1119159508 14:72441453-72441475 GGGGCAGGAAATGCACCACCAGG + Intronic
1119172363 14:72544954-72544976 GGGGCAGGAGCTGCTTCTGCCGG - Intronic
1120332485 14:83111632-83111654 GGGGGAGGCCATGCATGTGCAGG + Intergenic
1120384472 14:83827053-83827075 GTGGCAGGACATGGATTTTGCGG - Intergenic
1120881691 14:89418773-89418795 GGGGCAGGACCTGCATTAGCCGG - Intronic
1122205867 14:100147667-100147689 GGGGCAGGAAAGGCATCCTGGGG - Intronic
1122890360 14:104729384-104729406 GGGGCAGGGCATGCGCCATCTGG + Intronic
1202902055 14_GL000194v1_random:49777-49799 GGGGCAGGACAGGTGTCTCCTGG + Intergenic
1123931394 15:25173358-25173380 GGGGCAGGCTGTGCATCTGCTGG + Intergenic
1130964814 15:88689344-88689366 GGGTCAGGAAATGAAGCTTCAGG - Intergenic
1131332455 15:91514485-91514507 GGGGCAGAACATTCATGTCCAGG + Intergenic
1131718100 15:95135616-95135638 GGAGCAGTACATGCAGGTTCTGG - Intergenic
1132557516 16:579078-579100 AGGACAGGCCATGGATCTTCAGG - Exonic
1132799634 16:1745586-1745608 GGGGCTGGACATGCATGGCCTGG + Intronic
1134269757 16:12723294-12723316 TGGGCAGGATATGCCTGTTCTGG + Intronic
1136081025 16:27852731-27852753 GGGGCAGGAATTGCAACTTTCGG + Intronic
1136394779 16:29987021-29987043 GGGGAAGGACAACCATCTCCAGG - Exonic
1136581679 16:31155455-31155477 GGGGCCGGACATTTATGTTCTGG - Intergenic
1138694379 16:58798023-58798045 GGGAGGGGACATGCATATTCAGG + Intergenic
1139619560 16:68126569-68126591 GGGGCAGTAAAAGCATCTACTGG + Exonic
1139692740 16:68651358-68651380 GGGGCAGGATATGGTTCTTGGGG + Intronic
1140570030 16:76092984-76093006 GTGGCATGACCTGCATCTTTAGG - Intergenic
1141862791 16:86729425-86729447 GGGGAAAGACATGCATCTCTAGG + Intergenic
1142027131 16:87820449-87820471 GGGGCAGGACACGCATTTCCAGG - Intergenic
1142274110 16:89106906-89106928 GTGGCTGCACATCCATCTTCCGG - Intronic
1142366364 16:89652125-89652147 TGGGCAGCACAAGCAGCTTCCGG + Intronic
1145250373 17:21293925-21293947 GGGGGTGGCCATGCACCTTCAGG - Intronic
1145878554 17:28337756-28337778 GGGACAGGAAAAGCATCTTTGGG - Intronic
1148346809 17:46908703-46908725 GGGTCAGCACCTGCACCTTCCGG + Intergenic
1148667109 17:49383069-49383091 GGGGCAGGGCAGGCGTCTCCTGG - Intronic
1160816092 19:1036484-1036506 GGGGCAGGATATGGTTCTTGGGG - Exonic
1163634627 19:18432284-18432306 GGGGCAGGTCCTGAATCCTCAGG + Intronic
1165343190 19:35226830-35226852 TGGGAAGGACATGCATTTTGCGG - Intronic
925062674 2:905244-905266 TGAGCAGGACGTGCCTCTTCTGG - Intergenic
927999228 2:27508128-27508150 GGAGCAGGAGAGGCATCTCCAGG - Intronic
929938133 2:46309854-46309876 GGAGCAGTGCATGCCTCTTCTGG + Intronic
934777861 2:96950369-96950391 GGAGGAAGACATGCAGCTTCTGG - Intronic
937465772 2:122131779-122131801 AGGGCAGGACATGTTTCTTTGGG + Intergenic
944688565 2:202139413-202139435 GAGGCAGCACATGCAGCTCCAGG + Intronic
948211931 2:236200582-236200604 AGGGCAGAACATGCATTCTCTGG - Intronic
948826829 2:240577077-240577099 GGGGCAGGCCAGGCACATTCTGG + Intronic
948992756 2:241563126-241563148 GGGCCAGGAGATGCCTCTCCAGG - Intronic
1168980190 20:1997357-1997379 GGGGCAGGAATTGCATCTAATGG - Intergenic
1169091339 20:2862987-2863009 GGGGCTGGAGATGCGTCTGCAGG + Intronic
1170371197 20:15650124-15650146 GGGGAAGGACTTGCTGCTTCTGG + Intronic
1172794823 20:37529370-37529392 GGGGCAGGAGATACATATTTGGG + Intergenic
1172842144 20:37908346-37908368 GGGGCAGGAGATGGAGCTTTTGG + Intronic
1174762556 20:53220703-53220725 GGGGCCGGTCATGCATCCTGTGG + Intronic
1176257580 20:64160194-64160216 GGGGGAAGGGATGCATCTTCAGG + Intronic
1176621424 21:9064544-9064566 GGGGCAGGACAGGTGTCTCCTGG + Intergenic
1178631914 21:34268743-34268765 GGGGCAGGAGAGGAAACTTCAGG + Intergenic
1179257738 21:39731388-39731410 ATGGAAGGACATGCATCCTCAGG - Intergenic
1179829715 21:43989052-43989074 GCGGCAGGGCATGCACCTGCTGG - Intergenic
1179921616 21:44510547-44510569 GGGGCTGCCCAGGCATCTTCTGG + Intronic
1180064969 21:45407763-45407785 GGGGCAGGACATGCATCTTCTGG - Intronic
1181977382 22:26740511-26740533 GGGGAAGGACGTGCATTCTCTGG + Intergenic
1182583106 22:31327061-31327083 GAGCCCGGACATGCACCTTCTGG + Exonic
1183063286 22:35348183-35348205 TGGGGAGGGCATGCATCCTCCGG - Intergenic
1184254256 22:43278174-43278196 GGGCCAGGACAGGCCTCCTCCGG + Intronic
1184785416 22:46669211-46669233 TGGGCAGGACATGCCTCTTGGGG + Intronic
1184879085 22:47293774-47293796 TGGGAAGGACATGCATTTTGAGG + Intergenic
950973303 3:17211982-17212004 GGGGCAAGACACTCAGCTTCTGG - Intronic
951583274 3:24188126-24188148 GGGGTAGGACATGAGGCTTCAGG - Intronic
952333318 3:32384435-32384457 GGGGCTGGACATCCATGTTTGGG - Intergenic
953336946 3:42101519-42101541 GGGGAAGGACATGACTCTTACGG + Intronic
953547707 3:43875785-43875807 GGGGCAAGAGAGGCATCATCTGG + Intergenic
954874987 3:53796334-53796356 GGGCCAGGCCATTCATCTTCAGG - Intronic
961244577 3:125440438-125440460 GGGCCCTGACATGCATCTGCAGG + Intergenic
962900887 3:139760546-139760568 GGAGAAGGACAGGCATCTTGAGG + Intergenic
966001563 3:174954879-174954901 GAGCTAGGGCATGCATCTTCTGG + Intronic
968757886 4:2426241-2426263 AGTGCAGGACATGCACCTTGGGG + Intronic
969028272 4:4191593-4191615 GGGGCTGGCCACGCATGTTCAGG - Intronic
970418741 4:15884510-15884532 GCTGCAGGACATGCAACTGCTGG + Intergenic
975801518 4:78063584-78063606 TGGGCAAGCCATGCATCTGCTGG - Intronic
980680132 4:136150127-136150149 TGGGAAGGGCATGCTTCTTCTGG + Intergenic
982276332 4:153640089-153640111 GGGGCAGGAGAGGCAGCTGCGGG + Intergenic
986009436 5:3698884-3698906 TGTGCTGGACATGCATCTGCAGG + Intergenic
990515571 5:56528112-56528134 GGGCCAGGACATGCTGCTTTTGG - Intronic
992883318 5:81131783-81131805 GGGGCAGGATATGGATTCTCTGG - Intronic
994920903 5:106041787-106041809 TGGGAAGGACATGCATTTTCAGG - Intergenic
997389920 5:133506049-133506071 GGGGAAGGACCTTCACCTTCAGG + Intronic
997427550 5:133814262-133814284 TGGGCAGGATGTGCATCCTCCGG + Intergenic
999670643 5:153956412-153956434 GGGGTGGGATATGCATATTCAGG + Intergenic
1000040418 5:157480857-157480879 GCGGCCAGACATGCTTCTTCAGG + Exonic
1002539314 5:179895503-179895525 GCGGCAGGACCTGCAGTTTCAGG + Intronic
1002874617 6:1200347-1200369 GGGGCTGGTCATGCTTCTCCAGG - Intergenic
1003125229 6:3350575-3350597 GGGCCAGAACATGAATATTCTGG - Intronic
1003333756 6:5151547-5151569 AGGGCAGGATAAGCATTTTCTGG - Intronic
1003423841 6:5983295-5983317 AGGGCAGGAAAAGCAGCTTCAGG + Intergenic
1008048915 6:46880212-46880234 GTGGCAGGACATACCTCCTCAGG - Intronic
1008330549 6:50240072-50240094 GTGGCAGGGCAGGCAGCTTCAGG + Intergenic
1009452011 6:63812304-63812326 GGAGCAGGCCATGCAGCTTTTGG - Intronic
1010250516 6:73702360-73702382 GAGGCATGAAATGCATGTTCAGG - Intronic
1011817870 6:91213820-91213842 GGGGGAGGGCATGAATCTTGGGG - Intergenic
1013033276 6:106356890-106356912 GAGGCAGGAAATTAATCTTCTGG + Intergenic
1018366999 6:163130877-163130899 TGGGAAGGACATGGATCTTGCGG - Intronic
1019085166 6:169468674-169468696 GGGGCAGGATCTGCATTTTGAGG + Intronic
1022425785 7:30267459-30267481 GGGGCAGGCAATGGATGTTCAGG + Intergenic
1023637956 7:42231579-42231601 GGAGCAGGCCATGCCACTTCAGG - Intronic
1027263863 7:76483221-76483243 GGGGCAGGAGCCGCATCTGCAGG - Intronic
1027315234 7:76981334-76981356 GGGGCAGGAGCCGCATCTGCAGG - Intergenic
1027575297 7:79923091-79923113 GTGGCAGGGCAGGCATCTCCAGG - Intergenic
1028383497 7:90225705-90225727 AGGTCAGGACATTAATCTTCAGG - Intronic
1031875480 7:127134767-127134789 TAGGCAAGACATACATCTTCTGG + Intronic
1033897944 7:146097387-146097409 AGGGCAGTAAATGGATCTTCGGG + Intergenic
1036632982 8:10528528-10528550 GAGGCAGGAAATGCCCCTTCCGG - Intronic
1037923769 8:22828895-22828917 GGGGGATGACAAGCAGCTTCAGG - Intronic
1039875212 8:41578697-41578719 GGGTAAAGACATGCATCTTACGG - Intronic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1048592838 8:135837493-135837515 TGGGCTGAAAATGCATCTTCAGG - Intergenic
1049361409 8:142214011-142214033 GGGGCAGGACAGGTGTCTCCAGG - Intronic
1049545858 8:143230221-143230243 GAAGCAGGTCATGCACCTTCAGG + Intergenic
1051027950 9:12636625-12636647 AGGGCAGGACATGCAAGATCTGG - Intergenic
1052074127 9:24119547-24119569 GGGGCATTACATTCATCCTCAGG - Intergenic
1059958747 9:119544843-119544865 GAGGCAGAACATGCAGCTCCAGG - Intergenic
1061669226 9:132179261-132179283 GGGGCCGGAGCTGCCTCTTCAGG + Intronic
1062311569 9:135940673-135940695 GGGGAAGGACATACATTTTCTGG + Intronic
1062339394 9:136087320-136087342 GGGGCAGGGTATCCATCTCCTGG - Intronic
1186636388 X:11409513-11409535 GGAGCAGGACATCCATACTCAGG + Intronic
1187995819 X:24925308-24925330 GAGGCAGGCCTTGCATCTTCTGG + Intronic
1190792096 X:53710118-53710140 TGGGCTGAACATGCAACTTCTGG + Intergenic
1192360203 X:70434437-70434459 GGGGCAGCACTGGCATCCTCGGG + Intergenic
1201157953 Y:11149997-11150019 GGGGCAGGACAGGTGTCTCCTGG + Intergenic
1202073412 Y:21015668-21015690 GTGGCAGGACAGGCAGCTCCTGG + Intergenic
1202078112 Y:21057522-21057544 GTGGCAGGACAGGCAGCTCCTGG + Intergenic