ID: 1180065673

View in Genome Browser
Species Human (GRCh38)
Location 21:45411052-45411074
Sequence AGGTGGACGCTGCAGCTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180065673 Original CRISPR AGGTGGACGCTGCAGCTGGG CGG Intronic
900096217 1:941165-941187 AGGTGGCGGCTGCAGCTCTGAGG + Exonic
900118851 1:1040164-1040186 TGCTGGACGCTGCAGCAGCGCGG + Intronic
900139427 1:1133355-1133377 AGGATGACGCTCCGGCTGGGTGG + Intergenic
900251205 1:1670956-1670978 CGGTGGACGCTGCACTTCGGGGG - Intronic
900702658 1:4057934-4057956 AGCTAGACGCTGCAGCCTGGAGG + Intergenic
900963889 1:5944264-5944286 AGGAGGACGCTGCAGCCGGAAGG + Intronic
900998813 1:6137175-6137197 AGGTGGAGGCTGCAAGTGAGTGG - Intronic
901646945 1:10721905-10721927 AGGTGGGAGTGGCAGCTGGGCGG - Intronic
902135683 1:14302930-14302952 GGGTGGAGGCTGCAGCAAGGTGG + Intergenic
902197100 1:14805825-14805847 AGGTGGGAGCTGGATCTGGGGGG + Intronic
902212116 1:14911744-14911766 CAGTGGGCTCTGCAGCTGGGAGG + Intronic
902468730 1:16633326-16633348 AGGGACCCGCTGCAGCTGGGAGG - Intergenic
904945211 1:34194019-34194041 AGGAGGTGGTTGCAGCTGGGGGG + Intronic
905170426 1:36106647-36106669 TGATGGAGGGTGCAGCTGGGAGG + Intronic
905281141 1:36850194-36850216 AGATGGAGGCTGCAGGTAGGTGG - Intronic
905438824 1:37979785-37979807 AGGTTGAGGCTGCAGCAGTGAGG + Intronic
905991884 1:42344706-42344728 AGGTGGAGGCTGCAGGGAGGCGG + Intergenic
906340519 1:44975897-44975919 AGGTGGAGGCTGCAGTGAGGTGG + Intronic
906448378 1:45922714-45922736 CGGTGGTGGCTGCACCTGGGGGG + Intronic
908819351 1:68067391-68067413 AGGTGGGGCCTGAAGCTGGGTGG + Intergenic
910257019 1:85259053-85259075 AGGGAGAAGCTGCAGCGGGGGGG + Intronic
912659059 1:111512616-111512638 ATGTGAGTGCTGCAGCTGGGTGG + Intronic
912681082 1:111729498-111729520 ATTTGGAGGCTGCAGCGGGGCGG + Intronic
913105928 1:115613930-115613952 AGGTGGAGGCTGAGGGTGGGAGG - Intergenic
916855455 1:168744580-168744602 AGGGGCACTGTGCAGCTGGGAGG - Intergenic
919977010 1:202619338-202619360 AGGTGAAGGCTGCAGCTGCCCGG + Intronic
921322285 1:213953713-213953735 AGGTGGAGGCTGGGGGTGGGAGG - Intergenic
921492653 1:215797489-215797511 AGGTTGACTCTCCTGCTGGGGGG + Intronic
924436795 1:244049215-244049237 ACGGGGCCGCTGCAGCTGCGGGG + Intronic
924942878 1:248824800-248824822 AGGTGGAAGCAGCAGCAGTGAGG - Exonic
1065020791 10:21500400-21500422 AGGTTGACGCAGCTGCTAGGGGG + Intergenic
1068874784 10:61984543-61984565 ATGTGGAGGCAGCAGGTGGGGGG + Intronic
1069721694 10:70553898-70553920 AGGTTGTGGGTGCAGCTGGGAGG + Intronic
1069736888 10:70662298-70662320 AGGGTGACTCTGCCGCTGGGGGG + Intergenic
1070577018 10:77687066-77687088 CTGAGGACACTGCAGCTGGGAGG - Intergenic
1075649809 10:124120011-124120033 AGGCGGAAGCTGCAGCAGGATGG - Intergenic
1075717935 10:124567635-124567657 AAGTGGCCGCTGCGGCTGGCTGG - Intronic
1076727766 10:132421422-132421444 AGTAGGGGGCTGCAGCTGGGGGG + Intergenic
1077038789 11:508233-508255 AGGTGGAGGCTGCAGCGAGCTGG - Intergenic
1077239813 11:1504638-1504660 AGGTGGAGGCTGCAGCGAGCGGG + Intergenic
1077367705 11:2167803-2167825 AGGCTGACGCTGGACCTGGGGGG - Intronic
1077376817 11:2209121-2209143 CGGTGGACAGTGCAGGTGGGGGG + Intergenic
1077394950 11:2316134-2316156 AGGTGGGCGCTGCAGCTCCATGG + Intronic
1077434847 11:2534032-2534054 CAGTGGAGGCTGCAGCTGGCGGG - Intronic
1077871437 11:6265545-6265567 AGGTGGAGGCTGGGGGTGGGAGG + Intronic
1078699591 11:13668389-13668411 AGGTGGGCCCTGCGGCCGGGAGG - Intergenic
1078744303 11:14096574-14096596 CAGTGGAGGCTGCAGGTGGGTGG + Intronic
1080639174 11:34148825-34148847 AGGGGGCCGCTGAGGCTGGGAGG + Intergenic
1081638851 11:44739198-44739220 AGGTGGAGGCTGCAACAGGGTGG + Intronic
1083291321 11:61691842-61691864 AGGTGGAAACTGCAGCTGAGAGG - Intronic
1083324545 11:61866656-61866678 AGGAGGGCACTGGAGCTGGGAGG + Exonic
1084787644 11:71452927-71452949 AGAGGGGTGCTGCAGCTGGGCGG + Intergenic
1085251281 11:75145446-75145468 ATGGGGACTCTGCAGGTGGGCGG - Intronic
1085531675 11:77195455-77195477 GGGTGGAGGCTGCAGCTGTTTGG - Intronic
1085729282 11:78982645-78982667 TGTTGGATGTTGCAGCTGGGTGG - Intronic
1086949944 11:92881945-92881967 AGCTGGGGGCTGCAGGTGGGTGG - Intronic
1087433805 11:98087322-98087344 AGGTGGACTCTGTACTTGGGTGG + Intergenic
1090051193 11:123381263-123381285 AGGAAGAGGCTGCTGCTGGGTGG + Intergenic
1090266892 11:125359004-125359026 GAGTTGAAGCTGCAGCTGGGTGG + Intronic
1090267846 11:125364878-125364900 AGATGGGAGCTTCAGCTGGGTGG - Intronic
1090558104 11:127898631-127898653 CGGGGGACGCTCCAGCTGCGCGG + Intergenic
1091327495 11:134701909-134701931 AGGTGGACACTTCAGCCGGAGGG + Intergenic
1091645548 12:2269854-2269876 TGGTGGGAGCTGTAGCTGGGAGG + Intronic
1092000033 12:5024301-5024323 AGGTGCTCTCTGCAGCTTGGAGG + Intergenic
1092993970 12:13930470-13930492 AGGTGGATGCTGCTGTTGCGTGG - Intronic
1095954293 12:47797581-47797603 AGGGGGAGGCTGCAGCGGGCAGG + Intronic
1097650983 12:62296996-62297018 AGGTGGTTGCTGCAGCTGGAAGG + Intronic
1103717784 12:122955779-122955801 AGGTGGAGGCTGCAGTTAGCTGG - Intronic
1103734988 12:123055232-123055254 AGAAAGACGCTGCAGCTGGTTGG + Intronic
1103922026 12:124404111-124404133 AGGTGGAAGCTGGGGCAGGGAGG + Intronic
1103992430 12:124808067-124808089 AGGAGGTCGCTGCAGCTCCGCGG - Intronic
1106537763 13:30663004-30663026 AGGTGGAGGCTGAACCCGGGAGG - Intergenic
1109073570 13:57804119-57804141 AGGTGAATGCTCCAGCTGGAAGG - Intergenic
1109630184 13:65034653-65034675 AGGGGCAGTCTGCAGCTGGGTGG - Intergenic
1111178848 13:84635820-84635842 AGGAGGAGGCTGTAGGTGGGTGG - Intergenic
1111753834 13:92367857-92367879 ATGAGGACGGTGCAGGTGGGTGG + Intronic
1112337881 13:98529346-98529368 AGTTGGAGGCTGCTGCTGTGGGG - Intronic
1115036125 14:28858730-28858752 AGATGGAAGCTGCTGCTGAGAGG - Intergenic
1115470697 14:33765782-33765804 GAGAGGAAGCTGCAGCTGGGTGG + Intronic
1119262420 14:73245639-73245661 AGATGGAGGCTCCAGCTGCGTGG + Exonic
1122695654 14:103550939-103550961 AGGTGGCGGCTGCAGGTGGCTGG - Intergenic
1122784597 14:104157913-104157935 AGAAGGAGGCTGCAGCTGAGGGG - Exonic
1123151027 14:106181932-106181954 ATGTGGATGCTGCAGCCAGGAGG - Intergenic
1123399438 15:19969790-19969812 ATGTGGATGCTGCAGCCAGGAGG - Intergenic
1124492668 15:30167722-30167744 AGGTGAAGGCTGCAGCTGTCCGG + Intergenic
1124750866 15:32370603-32370625 AGGTGAAGGCTGCAGCTGTCCGG - Intergenic
1125680286 15:41526315-41526337 AGGTGGAGGCTGCAGTGGGCTGG - Intronic
1126105444 15:45144138-45144160 CTGTGGAGGCTGCAGCTGGATGG - Exonic
1127965885 15:63922656-63922678 AGCTGGAGGCCGCAGCAGGGTGG + Intronic
1128524650 15:68404058-68404080 AGCTGGAAGCAGCAGATGGGAGG - Intronic
1130876375 15:88018164-88018186 AGCTGGACCCTGCTTCTGGGAGG + Intronic
1131548973 15:93340006-93340028 TGGTGGACACTGCAGCAGGATGG - Intergenic
1132178358 15:99733203-99733225 AGGGGGACGCTCCAGCTGGAGGG - Intronic
1132218103 15:100082831-100082853 ACCAGGAGGCTGCAGCTGGGTGG + Intronic
1132317096 15:100898128-100898150 CGGGTGACGCTGGAGCTGGGGGG + Exonic
1132579289 16:677754-677776 AGAGGGACGCGGCAGGTGGGAGG - Intronic
1132669402 16:1096500-1096522 AGATGGAAGCTGTGGCTGGGCGG + Intergenic
1133442967 16:5836181-5836203 ACATGGGCTCTGCAGCTGGGGGG + Intergenic
1134208119 16:12253956-12253978 ATGTGGATGCTGGAGCTGGAAGG + Intronic
1134227588 16:12403547-12403569 AGGTGGACATCACAGCTGGGTGG + Intronic
1136067147 16:27766926-27766948 AGGTGGAGACTCCAGCTGTGTGG - Intronic
1136228819 16:28875497-28875519 AGGTGGGGGCTGAAGCTGAGGGG - Intergenic
1136628226 16:31474549-31474571 GGCTGGAAGCTGCAGCGGGGAGG - Exonic
1136902206 16:34051235-34051257 AGCTGGGCGCTGCAGCAGTGGGG + Intergenic
1137530826 16:49277820-49277842 AGCTGGGAGCTGCAGCCGGGTGG - Intergenic
1138214061 16:55187575-55187597 AGGTTGGCTGTGCAGCTGGGTGG - Intergenic
1139574764 16:67833888-67833910 AGGCGGAGCCTGCAGCTGGCTGG - Exonic
1140470257 16:75209764-75209786 AGGTGGAGGCTGCAAGTGAGCGG + Intergenic
1141142956 16:81509284-81509306 CGGTGGGCTCTCCAGCTGGGTGG - Intronic
1141896779 16:86963404-86963426 ATGCGGACGCTGGAGGTGGGAGG + Intergenic
1141968238 16:87461695-87461717 AGGCGGAAGCTGGAGTTGGGAGG + Intronic
1142177255 16:88650915-88650937 CGGTGGAGGCTGCAGCCTGGAGG - Intronic
1142964776 17:3573625-3573647 ATCTGGAAGCTGCAGGTGGGTGG - Exonic
1143287001 17:5797604-5797626 TGGTGGAGGCTGCAGCTGGAAGG - Intronic
1143524258 17:7463185-7463207 AGGTGGAGCCTGCAGCTGAGAGG + Exonic
1143717173 17:8782449-8782471 ATGTGGAAGCTACAGCTGGTTGG - Intergenic
1144305387 17:13965499-13965521 ACTTGGACGCTGCTGCAGGGCGG - Intergenic
1145067296 17:19770473-19770495 AGGAGAAGGCAGCAGCTGGGTGG + Intergenic
1145991169 17:29080308-29080330 GAGCGGACGCTGGAGCTGGGAGG + Intronic
1148105267 17:45115350-45115372 AGGTGGAGGCTGCAGCGCAGAGG - Exonic
1148680308 17:49469984-49470006 GGGTGGACGGGGCAGGTGGGAGG + Intronic
1152018921 17:77770435-77770457 AGGTGGAGACTGCAGCAGGGGGG + Intergenic
1152262387 17:79274120-79274142 AGGTGGACACTGCTGGTGGGAGG - Intronic
1152740385 17:82016059-82016081 AGGGGGAATCTGGAGCTGGGAGG + Intronic
1153886955 18:9475645-9475667 AGGCGGAGGCTGCGGCGGGGCGG + Intronic
1155174415 18:23290141-23290163 AGGTGCACTCTCCAGCTGTGTGG - Intronic
1155464624 18:26120889-26120911 AGCTGGAGGCCCCAGCTGGGAGG - Intergenic
1158681237 18:59568925-59568947 AGGTGGAGGTGGCAGGTGGGAGG - Intronic
1160441907 18:78899498-78899520 AGGTGGCGGCTCCACCTGGGTGG + Intergenic
1160472244 18:79146350-79146372 AGGTGCACGCTGCATGTCGGGGG + Intronic
1160878931 19:1310871-1310893 GGGAGGACCCTGCAGCTGTGCGG - Intergenic
1160892107 19:1384379-1384401 AGGTGGAGGGTCCAGCAGGGTGG - Intronic
1160974410 19:1785521-1785543 TGGTGGTCGCTGAAGCTGGCGGG + Exonic
1161242173 19:3228599-3228621 TGGGGGACGGTGCAGGTGGGGGG + Intronic
1161602585 19:5193540-5193562 AAGGGGTGGCTGCAGCTGGGAGG - Intronic
1162046339 19:8002777-8002799 AGGTGGAGGCTGCAACAGGCAGG + Intronic
1162464983 19:10834547-10834569 AGGTGGAAGTTGAACCTGGGAGG - Intronic
1163545978 19:17941803-17941825 AGGGGGACACTGCAGGTGTGGGG + Intronic
1165732206 19:38152976-38152998 GGGTGGGCGCAGCAGCTGGTGGG - Intronic
1165858702 19:38895224-38895246 AGGTGGAGACTGAGGCTGGGAGG - Intronic
1165943109 19:39425092-39425114 AGGTGGTGGCTGGGGCTGGGGGG - Exonic
1166015219 19:39974445-39974467 AGGGGGAGCCTGCAGCTGGGAGG + Intronic
1166118067 19:40667708-40667730 AGGCTGAGGCTGGAGCTGGGCGG + Exonic
1166256988 19:41613693-41613715 AGGTGGTCACTGCAGCAGGCAGG + Intronic
1166791328 19:45400386-45400408 AAGTGGTCGATGCAGCAGGGAGG - Intronic
1166896001 19:46022292-46022314 AGGAGGAAGCTGAAGCCGGGAGG + Intronic
1167216835 19:48170688-48170710 AGGTGGACGCCGCTCCGGGGCGG + Exonic
1168089620 19:54074053-54074075 CGCTGGACTCTGCAGCTGGATGG + Exonic
925044137 2:758462-758484 AGGTGCACCCCGCAGCAGGGCGG - Intergenic
926229668 2:10992909-10992931 AGGAGAACACTGCAGCTGGCAGG - Intergenic
926354056 2:12023530-12023552 AGGTGGTGGGTGAAGCTGGGGGG - Intergenic
928511853 2:32010352-32010374 AGGAGGAGGCGGCAGCGGGGAGG + Exonic
929531153 2:42753710-42753732 AAGTGGCCGCTGTTGCTGGGTGG - Exonic
931135872 2:59399790-59399812 AGGTGGACCCTGAGGCTAGGTGG - Intergenic
931191486 2:60005092-60005114 AGGTGGAGGTTGCAGCAGTGAGG - Intergenic
932702643 2:74002057-74002079 AGGTGGGCGCTGGAGCAGGGAGG + Intronic
935334764 2:102006232-102006254 AGGAGGACACAGCAGCTTGGTGG + Intronic
936097003 2:109538113-109538135 AGGTGGCCTCTGGAGCTGGGAGG - Intergenic
937953116 2:127403533-127403555 ACCTGGAGGCTGCAGTTGGGAGG - Intergenic
938518187 2:132037894-132037916 AGCCGGACGCTGCAGCAGTGCGG - Intergenic
941288843 2:163649433-163649455 ATGTGGCCTCTGCAGCAGGGTGG - Intronic
944831034 2:203534724-203534746 AGCTGGTTTCTGCAGCTGGGCGG + Intronic
946153238 2:217790063-217790085 AGGTGAGAGCCGCAGCTGGGTGG - Intergenic
949059272 2:241947397-241947419 CCGTGGACGCTGCATCTGGGCGG - Intergenic
949059363 2:241947859-241947881 AGGTGGAGGCTGTCGCTGGAGGG - Intergenic
1169017598 20:2304498-2304520 AGGTGGACGATGCAGCATGAGGG + Intronic
1169164079 20:3407580-3407602 AGGAGGACGGTGCAGCTGCGAGG + Exonic
1169851231 20:10053719-10053741 TGGTGGAGGCGGCAGGTGGGAGG - Intronic
1170736060 20:19015152-19015174 AGGTGGAGTCTACATCTGGGTGG - Intergenic
1171103352 20:22407725-22407747 AGGAGGAGACTGCAGCAGGGAGG + Intergenic
1172257714 20:33534387-33534409 AGGTGGAGGCTGCAGCGAGCTGG - Intronic
1173589072 20:44210405-44210427 AAGGGGAAGCTGCCGCTGGGCGG + Intronic
1174450547 20:50617446-50617468 AGGTGGAGGCTGCAGCAAGCTGG - Intronic
1175079740 20:56409113-56409135 AGGTGGAGGCTGCAGTAGAGTGG - Intergenic
1175262791 20:57685219-57685241 AGCTGGAGGTTGCAGCCGGGTGG - Intronic
1175328852 20:58148881-58148903 AGGGGGCCGGTGCAGCTGGAGGG - Intergenic
1176204140 20:63879035-63879057 AGGTGGCGGCAGCAGCTGTGAGG - Intronic
1177030122 21:15972419-15972441 ATGTGGACGGTGCTGCTGGCAGG - Intergenic
1178839975 21:36130362-36130384 AGGAGGAGGCGGCAGCGGGGAGG - Intergenic
1179050901 21:37887935-37887957 AGGTGGCCTCTGAAGCTGTGTGG + Intronic
1179614159 21:42570951-42570973 AGGTGGGCGCGGCAGCTCCGCGG - Intronic
1180065673 21:45411052-45411074 AGGTGGACGCTGCAGCTGGGCGG + Intronic
1181087379 22:20447454-20447476 AGGTGGACGGAGCAGTGGGGAGG + Intronic
1183645633 22:39124385-39124407 AGGTGGACGGTGAAGCGTGGGGG + Intronic
1183662860 22:39231628-39231650 AGGTCGCAGCTGCACCTGGGTGG + Exonic
1183803419 22:40187582-40187604 AGGTGGTGGCTTCAGGTGGGGGG + Intronic
1183952080 22:41357706-41357728 AGCTGGAGGCTGAAGCTGGAGGG - Exonic
1184617098 22:45645695-45645717 AGGTGGACTCCGCTGCTGCGTGG + Intergenic
1185295988 22:50055111-50055133 GGGAGGAGGCTGCAGCTCGGGGG + Intronic
1185300518 22:50077550-50077572 CGGTGGACGCTGAAGCGCGGTGG - Intronic
949986643 3:9546407-9546429 TGGTGGACCCTGGAGGTGGGAGG - Intronic
950695970 3:14701391-14701413 ACTTCGAGGCTGCAGCTGGGTGG + Intronic
952751468 3:36828249-36828271 ATGAGGAGGCTGCAGCTGTGTGG + Exonic
953032063 3:39185770-39185792 GGGTGGTCTCTGCAGCTTGGAGG + Exonic
953436186 3:42879730-42879752 AGGAAGTCGCTGCAGATGGGTGG + Intronic
953636558 3:44669919-44669941 AGGAGGAGGCTGCAGCTATGGGG + Intergenic
955058626 3:55477367-55477389 AGCTGAAAGCTGCTGCTGGGTGG - Intronic
955622014 3:60874705-60874727 AGGTTGAGACTGCAGATGGGAGG - Intronic
955879704 3:63530318-63530340 GGGTGGACACTGCTCCTGGGTGG + Intronic
962263875 3:133931871-133931893 AAGTAGACGCTGGGGCTGGGTGG + Intergenic
967304155 3:188044502-188044524 AGGTGAAAGCTGAAGGTGGGGGG + Intergenic
967709387 3:192687693-192687715 TGGTGGAGGCAGGAGCTGGGGGG - Intronic
968165359 3:196460382-196460404 AGGTAGCAGCAGCAGCTGGGAGG + Intergenic
968547468 4:1206300-1206322 AGCTGGGGGCTGCAGCCGGGTGG - Intronic
968759948 4:2437471-2437493 AGGTGGCCAGTGCTGCTGGGGGG + Intronic
968949431 4:3682946-3682968 AGCTGGACTCTGGAGCTGGGAGG + Intergenic
973340624 4:48999806-48999828 ACATGGACCCTACAGCTGGGTGG - Intronic
981172118 4:141636838-141636860 AGGGTAACGCTGGAGCTGGGAGG - Exonic
984811387 4:183798335-183798357 AGGTGGGCGCCGCGGCTCGGCGG + Intergenic
984950194 4:185002392-185002414 AGGTGGAGGCTGAGGCTGTGGGG + Intergenic
985189214 4:187353493-187353515 AGGTGGACCCTCCAGTTGGCAGG - Intergenic
986710302 5:10483762-10483784 AGGTGGAGGCTGAGGCAGGGAGG + Intergenic
987062622 5:14257107-14257129 AGGTGGAAGCCGAAGATGGGAGG + Intronic
988838990 5:35065135-35065157 AAGTGCAGGCTCCAGCTGGGTGG - Exonic
990846325 5:60144110-60144132 AGGTCACCGCTGCCGCTGGGAGG - Intronic
991162501 5:63520554-63520576 TGGTGGACTCTGCTGCTGGAAGG - Intergenic
991275747 5:64844459-64844481 AGGTGGGCTCTGAGGCTGGGTGG - Intronic
992149870 5:73892369-73892391 AGGAGAAAGCTGCAGATGGGGGG - Intronic
993764236 5:91835473-91835495 AGGTGGAGGCACCAGTTGGGTGG + Intergenic
994072706 5:95620390-95620412 AGGCGGACGCGGCGGCTGGGCGG - Exonic
994969655 5:106719387-106719409 AGCTGGAAGCTGGAACTGGGTGG - Intergenic
995343912 5:111090407-111090429 AGCTGGAAGCTGGAACTGGGTGG - Intergenic
997013174 5:129903780-129903802 TGGTGGACGATGCAGGTAGGAGG + Intergenic
997365036 5:133320179-133320201 AGCTGGAGGCTGCAGCTTTGGGG - Intronic
999286233 5:150395926-150395948 AGATGGAGTCTGGAGCTGGGAGG - Intronic
999512422 5:152266550-152266572 TGGTGGGCTCTGGAGCTGGGTGG + Intergenic
1001329616 5:170752898-170752920 ATGAGGAAGCTGCAGCTCGGAGG - Intergenic
1001711939 5:173786141-173786163 GGGTGGAAACTGCAGCTGGCTGG - Intergenic
1001999716 5:176190964-176190986 TGGTGGGCCCAGCAGCTGGGGGG - Intergenic
1002794361 6:459504-459526 AGGTTGAGGCTGCACCTTGGGGG + Intergenic
1002896496 6:1383107-1383129 AGGTGGAGGCGGGAGTTGGGAGG + Intergenic
1003244632 6:4373600-4373622 AGGTGGCCCCTGCATCTGGATGG + Intergenic
1004350581 6:14886988-14887010 AGTTGGAGGCTGCAGGTGCGAGG + Intergenic
1005917931 6:30370436-30370458 TCTTGGAGGCTGCAGCTGGGAGG - Intergenic
1006465204 6:34189841-34189863 AGCTGGGCGCTGTACCTGGGCGG - Intergenic
1007256575 6:40533853-40533875 AGGTGGAGGCTGGAGCAGCGTGG + Intronic
1011530022 6:88311779-88311801 CGCTGGCTGCTGCAGCTGGGTGG + Intergenic
1012582063 6:100881355-100881377 ACGTTGGCGCTGCAGCGGGGCGG - Exonic
1014579167 6:123113624-123113646 AGGTAGAAGCTCCATCTGGGAGG - Intergenic
1014791666 6:125679344-125679366 AGGTTAGCGCTGCAGCTGGGAGG - Intergenic
1018035328 6:159876561-159876583 AGGTGGACGTTAGAGCTGGGTGG - Intergenic
1018213701 6:161506634-161506656 AGGAGGATGATGCAGGTGGGTGG + Intronic
1018251175 6:161872207-161872229 GGGAGGACGCAGCAGCTGAGTGG + Intronic
1018417916 6:163617357-163617379 AGGTGGAGGCTGCAGTGGGCCGG + Intergenic
1018683879 6:166286837-166286859 AGGTGGAAGGGGCCGCTGGGGGG + Intergenic
1019097979 6:169601604-169601626 AGGTGAACGCTGCAGCTGCAAGG + Intronic
1019189761 6:170245026-170245048 AGGAGGATGGTGCAGCTGTGGGG - Intergenic
1019682539 7:2359471-2359493 AGGTGGAGGCTTCTGCAGGGTGG + Intronic
1020009390 7:4800025-4800047 GGTTGGCCTCTGCAGCTGGGAGG - Intronic
1023921017 7:44629946-44629968 ATGTGGTCGCTGCAGGAGGGAGG + Intronic
1024022636 7:45385841-45385863 AGGTGGAAGGTTGAGCTGGGAGG + Intergenic
1025843539 7:65174599-65174621 ACATGGACACTGCAGGTGGGGGG - Intergenic
1025879505 7:65521367-65521389 ACATGGACACTGCAGGTGGGGGG + Intergenic
1025893933 7:65681221-65681243 ACATGGACACTGCAGGTGGGGGG - Intergenic
1026911238 7:74093093-74093115 AGGAGGAGGCTGCAGCCGCGTGG - Intronic
1028595996 7:92546889-92546911 AGGTGCCAGCTGCAGCAGGGAGG + Intergenic
1028889410 7:95970313-95970335 ACGTGGAGGCTGCAGGAGGGTGG - Intronic
1029490476 7:100867635-100867657 AGGTGAGCGCCACAGCTGGGTGG - Intronic
1030421313 7:109309964-109309986 AGAGGGAGGCTGCAGGTGGGTGG - Intergenic
1031606678 7:123776394-123776416 AGGTGAAAGCTGCAGGTGTGTGG + Intergenic
1032322881 7:130900526-130900548 AGGTGGCAGGTGCAGCTGTGTGG - Intergenic
1032433655 7:131882749-131882771 AGGTGGTAGCTCCAGTTGGGTGG - Intergenic
1032856886 7:135842320-135842342 ATGTGCCCCCTGCAGCTGGGGGG - Intergenic
1034350050 7:150409619-150409641 AAGTGGACGATGGAGCAGGGAGG + Intronic
1034491097 7:151393511-151393533 AGGTGGAGGCTGGTGCTGGACGG - Intronic
1034563310 7:151895067-151895089 AGGAGGACGCAGGAGCAGGGAGG - Intergenic
1034940422 7:155226916-155226938 AGGTGGGGGCATCAGCTGGGAGG - Intergenic
1034940497 7:155227338-155227360 AGGAGGAGGTGGCAGCTGGGTGG + Intergenic
1035010975 7:155714707-155714729 TGGTGGATGCTGCTGATGGGTGG + Intronic
1035609353 8:949603-949625 ATGAGGAAGCTGCAGCGGGGAGG - Intergenic
1035953051 8:4045133-4045155 GCGTGGCCGCTGCAGGTGGGAGG - Intronic
1037014591 8:13886575-13886597 CGGTGGACGATGGAGCTGGTTGG + Intergenic
1038683057 8:29687879-29687901 AGATGGCAGCTGCAGCTGGTTGG + Intergenic
1040087693 8:43363697-43363719 AGCTGGAGGCCTCAGCTGGGAGG - Intergenic
1044450963 8:92335558-92335580 GGCTGGAGGCTGCAGCTGGGAGG + Intergenic
1047028028 8:120845805-120845827 AGATGGACTCTGTAGCTGAGTGG - Intergenic
1047205573 8:122800478-122800500 GGGTGGCCGCTACAGCTCGGGGG - Intronic
1047395730 8:124497353-124497375 AGGTGGATGTTGCAGCTCGCCGG - Intronic
1047445262 8:124913732-124913754 GTGTGGAAGCTGCAGCTAGGAGG - Intergenic
1049717260 8:144098880-144098902 AGGTGGAAGCTGCAGCAAGGGGG + Exonic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1051913883 9:22185176-22185198 AGCTGGAGGCCTCAGCTGGGAGG - Intergenic
1052754711 9:32528632-32528654 AGGTGGAGGCTGCAGCAGCCTGG - Intergenic
1053506309 9:38646285-38646307 AGATGGACCCTGCAGCCAGGTGG - Intergenic
1054345401 9:63909370-63909392 AGGTGAACACATCAGCTGGGTGG - Intergenic
1057141438 9:92728905-92728927 CTGGGGACGCTGCAGCTGGCTGG - Intronic
1057223027 9:93267968-93267990 AGGTGGGCGCTGCAGCTCAGTGG + Intronic
1059281234 9:113135904-113135926 GGCTGGATGCTGGAGCTGGGCGG - Intergenic
1059450263 9:114367349-114367371 AGGAGGAGGCTGGAGCTGTGTGG + Intronic
1060172227 9:121471220-121471242 AGGGGGACTCAGCTGCTGGGTGG - Intergenic
1060524475 9:124312689-124312711 AGGTGGTCTCTGCATCTGGACGG + Intronic
1060596636 9:124852778-124852800 GGGTGGAGGCTGGGGCTGGGGGG - Intergenic
1060820772 9:126660453-126660475 ATGTGGATGCTGCAGCCAGGTGG + Intronic
1060994764 9:127869676-127869698 AGGTAGAAGCAGCCGCTGGGTGG - Intronic
1061039065 9:128129143-128129165 AGGAGGAGGATGAAGCTGGGAGG - Intergenic
1061083942 9:128388496-128388518 AGGTGGCCGGTGCAGTTGTGAGG + Intronic
1061925108 9:133802387-133802409 AGGGGGAGGCTGCCCCTGGGAGG - Intronic
1061946018 9:133908503-133908525 GGGTGGTCACTGCAGTTGGGGGG - Intronic
1062312609 9:135947157-135947179 ACGTGGACGCCGCAGCAGGCAGG - Intronic
1062352689 9:136146998-136147020 AGGGGCACGCACCAGCTGGGTGG - Intergenic
1062425257 9:136503316-136503338 AGGTAGACGATGGAGCTGGGCGG + Exonic
1062623410 9:137432764-137432786 AGGTGGCAGCTCCAGGTGGGTGG - Intronic
1186234966 X:7498045-7498067 AGGAGGACACTGCAGGTGGAAGG - Intergenic
1187880302 X:23841089-23841111 AACAGGAGGCTGCAGCTGGGCGG + Intronic
1188757051 X:33975075-33975097 AGGGGGAGGCTGCAGGTGGTTGG + Intergenic
1189244824 X:39555254-39555276 AGGTGGACCCTCCAGCATGGTGG - Intergenic
1191889350 X:65925047-65925069 AGATGGAGGCCCCAGCTGGGAGG + Intergenic
1195773327 X:108375633-108375655 TGGTTGAGGCTGCAGCTGGGAGG - Intronic
1197159685 X:123309275-123309297 AGGTGGAGGTTGAACCTGGGAGG + Intronic
1201298916 Y:12489496-12489518 AAGTAGAGGATGCAGCTGGGAGG + Intergenic