ID: 1180065888

View in Genome Browser
Species Human (GRCh38)
Location 21:45412097-45412119
Sequence GGAAAGAGAATGCACCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 265}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180065888_1180065893 13 Left 1180065888 21:45412097-45412119 CCCTGCAGGTGCATTCTCTTTCC 0: 1
1: 0
2: 1
3: 26
4: 265
Right 1180065893 21:45412133-45412155 TCTGTTGATGCTTTCAGCTCTGG 0: 1
1: 0
2: 1
3: 16
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180065888 Original CRISPR GGAAAGAGAATGCACCTGCA GGG (reversed) Intronic
900923069 1:5685881-5685903 GGCAAGAGAAGGAACCTGGAAGG + Intergenic
901953968 1:12770758-12770780 GGAAAGGGAAGGCCCCTGCCCGG + Intergenic
902090897 1:13902328-13902350 GGGAAGACAAAGCACCTTCACGG - Intergenic
902227172 1:15003772-15003794 GGGAAGAGTATCCAACTGCAGGG - Intronic
902246218 1:15122581-15122603 GGAAAGAGGAGGCCCCTGCCGGG - Intergenic
902327020 1:15707757-15707779 GGACAGAGACTGTACCAGCAAGG + Intronic
904051728 1:27643891-27643913 AGGCAGGGAATGCACCTGCATGG + Intergenic
905082131 1:35332904-35332926 GAAAAGATGATGCACCAGCATGG - Intronic
906480352 1:46195411-46195433 AGAAAGAGAAGGCCCCTGCAAGG - Intronic
907644463 1:56228097-56228119 GGAAAGAGCAGGCAGCTGCGGGG - Intergenic
907813129 1:57892022-57892044 GGATTGAGAATGCAGTTGCAAGG - Intronic
907921891 1:58921797-58921819 GGAAGGAGAATTAACCTTCATGG + Intergenic
909437652 1:75661869-75661891 GGAAGGGGAATGCTCGTGCATGG + Intergenic
909677286 1:78252573-78252595 GGGCAGAGAATGCACCTGAAGGG - Intergenic
910992133 1:93067407-93067429 GGACAGAGAATCAACCTGGAAGG - Intergenic
912082404 1:105952525-105952547 GGAAGCAGATTGCTCCTGCAGGG - Intergenic
913550166 1:119909854-119909876 GGAAAGAGAGTGAATCTGAAGGG - Intergenic
915825582 1:159072685-159072707 GGAGGGAGAATCCACCTTCAGGG - Intronic
916907325 1:169301444-169301466 GGAAAGAGAATGCTTATACACGG + Intronic
918216844 1:182399332-182399354 GGACAGAAAATGCACCAGCACGG + Exonic
918734590 1:188043044-188043066 GGAGAGAGCATGCAGCAGCAGGG - Intergenic
919765492 1:201124663-201124685 GGGAAGTGACTGCAGCTGCAGGG + Intronic
919981427 1:202644597-202644619 GCAAACAGAAAGCAGCTGCATGG - Intronic
920211430 1:204331716-204331738 GGAAAAAGAAAGCAACTGTAAGG + Intronic
923081621 1:230662072-230662094 GGAGAGTGAATCCACCTCCATGG - Intronic
923448120 1:234091530-234091552 GGGCAGAGAATGCACTGGCAGGG - Intronic
923448378 1:234093708-234093730 GGGCAGAGAATGCCCCGGCAGGG - Intronic
924082731 1:240416236-240416258 GGAAAGGGAATGTACAGGCAAGG - Intronic
1065787172 10:29227423-29227445 GGAAAGAGAACTCACCCACAAGG + Intergenic
1067199850 10:44157799-44157821 GGAAAGAGAGTGGGCCTGAAAGG + Intergenic
1067331042 10:45319426-45319448 GAAAAGGGAATGCTCATGCATGG - Intergenic
1070817214 10:79332082-79332104 GGAGAGATAATGCACCTTCTGGG + Intergenic
1071605912 10:86989107-86989129 GGAAAGATATTCCACCTTCATGG - Intergenic
1074943289 10:118255546-118255568 GGAAGGAGCAAGCACCAGCATGG + Intergenic
1075581077 10:123618938-123618960 GAAAAGAGAATGAAGCTGAAAGG + Intergenic
1075593908 10:123713526-123713548 GGCAAGAGAAAGCTTCTGCAGGG + Intronic
1077430530 11:2513861-2513883 AGAAAGAGAATTCACCTGCCCGG + Intronic
1077832660 11:5891736-5891758 AGAAAGAGAATGCCCGTGCAGGG - Intronic
1080261112 11:30350681-30350703 GGAAAGTGCCTGCACCAGCAAGG - Intergenic
1080800951 11:35609766-35609788 GGAAAGAGAAGACAGCTGCATGG + Intergenic
1082944952 11:58748810-58748832 GGAAGGAGAATTCAAGTGCAGGG + Intergenic
1084702892 11:70799042-70799064 GGAAAGAAAATCCACCTGCCCGG + Intronic
1086930470 11:92687693-92687715 GGGAAGAGAAAGCATCTGTATGG + Intronic
1088258659 11:107924909-107924931 GGAAAGAGAAAGCTGCTGCCGGG - Intronic
1090654478 11:128832523-128832545 TGAAGGAAAATGCACCTGGAAGG - Intergenic
1090676190 11:128999178-128999200 GGAAAGAGAATGCATTCCCAGGG + Intronic
1091195509 11:133727566-133727588 GCAAAGAGGATGCACCTCTAGGG - Intergenic
1091311829 11:134580419-134580441 GGAGAGAGATTCCATCTGCAGGG - Intergenic
1091566434 12:1652145-1652167 GAAAAATGAATGCACCTGCAGGG - Intergenic
1091781814 12:3218653-3218675 GGAAGGAGAAGGCACCAGGAAGG + Intronic
1091786291 12:3245115-3245137 GCAGAGGGAATGCACCTGCCTGG - Intronic
1092046550 12:5434959-5434981 GGAAAGACAAAGCATTTGCAGGG + Intronic
1092644035 12:10550072-10550094 GTGAAGAGATTGCACCTACATGG - Intergenic
1095735032 12:45547245-45547267 GGAAAGAGATTACACCTCAAAGG - Intergenic
1095979839 12:47965737-47965759 GGAAAGAGAAGGGAGCTGAAAGG - Intronic
1101426508 12:104592679-104592701 GGAAAGAGAATGAATCTACGTGG - Intronic
1104383908 12:128332433-128332455 AGAAAGAGAATACATCTTCAAGG - Intronic
1105874715 13:24541488-24541510 GGAAACAGACTGGACGTGCAGGG - Intergenic
1106028072 13:25974042-25974064 GGAAAAAAAATGCAGCTGGAAGG - Intronic
1106118166 13:26834965-26834987 GGAAACAGAATTTTCCTGCAAGG - Intergenic
1106619045 13:31356262-31356284 GGCAAGAGAGAGCACGTGCAGGG - Intergenic
1109247595 13:59975600-59975622 GGAGAGAGAATGCATGTGTAGGG - Intronic
1109828773 13:67757685-67757707 GGAAAAATAATGGACCTACATGG + Intergenic
1110046506 13:70839935-70839957 GGAAAGAGAAACAACCTTCATGG + Intergenic
1111323898 13:86665924-86665946 GGAAAAAGTATGCGCATGCAAGG - Intergenic
1112148079 13:96723707-96723729 AGAAAGAGAAGGCACTTGCCAGG - Intronic
1112862493 13:103849873-103849895 AGAAAGAAAATGCATCTGCCAGG - Intergenic
1114696525 14:24631836-24631858 GGTAAGACTATGCACCTGCCTGG - Exonic
1114797771 14:25736207-25736229 GGAAGGAGAATCCACAGGCATGG - Intergenic
1115348920 14:32372063-32372085 GGATATAGAATGCTCCTACAAGG + Intronic
1115514742 14:34174106-34174128 GGGGTGAGAATGCACCTCCATGG + Intronic
1116346358 14:43799985-43800007 GGAAAAAGAATGCATCTAAATGG + Intergenic
1116863759 14:50015113-50015135 GAAAAGAGAAAGAAGCTGCAAGG + Intergenic
1118393647 14:65317368-65317390 GGATAGAGAATGGAACTGGAAGG + Intergenic
1118718379 14:68576292-68576314 GGGAAGAGAATGAACATGAAGGG + Intronic
1118739972 14:68732237-68732259 GAAAAGAAAATGCCCCTGCCTGG + Intergenic
1119054509 14:71405547-71405569 AGAAAGAGAATGCCCCTTCTGGG + Intronic
1120037091 14:79710014-79710036 TGAAAGAGAATTAACCTGGATGG + Intronic
1121174538 14:91881198-91881220 TGAAAGAGAGTGCACCAGCCAGG - Intronic
1121782329 14:96629929-96629951 GTGGAGAGAATGCACCTGCAGGG + Intergenic
1123692525 15:22850450-22850472 GGAACGATAATGCACCTTAATGG + Intronic
1124497118 15:30193332-30193354 GCAAACAGAAAGCAGCTGCATGG - Intergenic
1124746458 15:32345315-32345337 GCAAACAGAAAGCAGCTGCATGG + Intergenic
1125735532 15:41922569-41922591 GAAGAGAGACTGCATCTGCACGG - Intronic
1126200284 15:45978032-45978054 TGAATGAGAATGCACGTGGAGGG + Intergenic
1127354447 15:58184690-58184712 AGCAAGAGAATGCAGCTGGAAGG + Exonic
1127587240 15:60390246-60390268 GGATACAAAAGGCACCTGCATGG - Intronic
1128322996 15:66705610-66705632 CGAAAGAGAATACACCTGCCAGG - Intronic
1128674215 15:69596760-69596782 GAAAGGAAAATACACCTGCAGGG - Intergenic
1131015142 15:89051697-89051719 GGCAAGAGAGAGCATCTGCAGGG - Intergenic
1131516193 15:93078728-93078750 GGGAAGAGAATACAACTGCCAGG + Intronic
1131569431 15:93519490-93519512 GAAAAGAGAATCCACCTTCTAGG - Intergenic
1132405943 15:101541968-101541990 GGGAAGAGACTGCACCTGGGAGG - Intergenic
1132680805 16:1141001-1141023 GGAAGGAGGATGCACCTTCCTGG - Intergenic
1133055429 16:3143349-3143371 TGAAAGAGAAGGAACCAGCATGG - Intergenic
1133434925 16:5770938-5770960 GGAAACAGAGTTCACCTGCCAGG - Intergenic
1135488421 16:22886080-22886102 GAAAAGAAAATGAACCTCCAGGG - Intronic
1137526574 16:49241624-49241646 GCAAAGAGAGAGCTCCTGCAGGG + Intergenic
1137924520 16:52527571-52527593 GGAAAAAGAAAACATCTGCAAGG + Intronic
1138244387 16:55456029-55456051 GGAAAAAGAATCAACCTGGAAGG + Intronic
1139366362 16:66436008-66436030 GAAAAGAGTTTGCCCCTGCAGGG - Intronic
1140156752 16:72437070-72437092 TGAAAGAGAATGCAACTAAATGG + Intergenic
1142357634 16:89609966-89609988 GGAAAGAGTGTGAACCTCCAGGG - Intergenic
1143327023 17:6105804-6105826 GGAAAAAAAATCCACCAGCATGG - Intronic
1143751562 17:9032018-9032040 GGAAACATATTTCACCTGCAGGG - Intronic
1144406372 17:14956417-14956439 GGAAAGAAAATCCTCCAGCATGG - Intergenic
1145166299 17:20615301-20615323 GGGAAGAGAATGCCACTGCTTGG + Intergenic
1145780169 17:27557489-27557511 GGAAGCAGGATGGACCTGCATGG + Intronic
1146414745 17:32621620-32621642 GAAAGGAGAAAGTACCTGCAAGG - Intronic
1147531438 17:41281854-41281876 GGAAATACAATACACATGCAAGG - Intergenic
1148027999 17:44601558-44601580 GGGCAGAGGAAGCACCTGCAGGG + Intergenic
1148729191 17:49820810-49820832 ACAAAGGGAATGCACTTGCAGGG + Intronic
1149770362 17:59316041-59316063 GGAAGGAGAATGCAGCAGAAAGG + Intergenic
1150671710 17:67206175-67206197 GGGAAGAGAATTTATCTGCAAGG - Intronic
1152402296 17:80074486-80074508 AAAAAGAGAATGCACCTGGTGGG + Intronic
1156407324 18:36795348-36795370 GGAAAGAGAATGAGCCAGCTGGG + Intronic
1157602832 18:48904815-48904837 GGATAGAGTATTCCCCTGCAGGG + Intergenic
1157989373 18:52476742-52476764 AGAAATAGAATCCAACTGCAAGG - Intronic
1160259376 18:77277412-77277434 GAAGAGAGAATGTACCAGCAGGG - Exonic
1160431068 18:78813003-78813025 GGAAAGAAAACGCTGCTGCATGG + Intergenic
1160458443 18:79019289-79019311 AGGCAGACAATGCACCTGCAGGG + Intergenic
1161298961 19:3533599-3533621 GGACAGGGCCTGCACCTGCAGGG - Intronic
1163063058 19:14774147-14774169 GGAAAGAGAGGGCTCGTGCACGG - Intronic
1163470966 19:17496731-17496753 GGAAAGACACTGCATCTGCTTGG + Intronic
1164218023 19:23168252-23168274 AGAAAGAGAATGCACACCCAGGG + Intergenic
1164504689 19:28850060-28850082 GGAAAGAGAAATGACATGCATGG + Intergenic
1164549635 19:29198361-29198383 AGAAAGAGAATGCACCTCTGAGG - Intergenic
1167469094 19:49665556-49665578 GGAAAGAGGATGGGTCTGCACGG - Exonic
1167602393 19:50461873-50461895 GGAGAGAGGATGCACCCGTAAGG - Intronic
1167724559 19:51201367-51201389 CGAAGGAGAATTCACCTGCCGGG + Intergenic
1167758197 19:51426488-51426510 TGGAAGAGAATTCACCTGCTGGG - Intergenic
1167951916 19:53034457-53034479 CAAAAGAGAATGCTCCAGCAAGG + Intergenic
1168666534 19:58209183-58209205 GGAAAGAGAAATCCCATGCAGGG - Intronic
926607733 2:14914365-14914387 GGGAAGAGACTGCACCAGCAAGG + Intergenic
926702769 2:15814734-15814756 GGAAAGATAATCCTCCTGGAAGG - Intergenic
927242286 2:20929599-20929621 GGAAAGAGAAAGTGCCAGCAGGG + Intergenic
927313080 2:21652001-21652023 GCAAAGAGAAGTCACCTGCAGGG - Intergenic
928162535 2:28941205-28941227 GGCAAGAGAGTGAAACTGCAAGG - Intronic
928924020 2:36557866-36557888 ACAAAGATAATGCACCTTCAAGG - Intronic
930055151 2:47246139-47246161 GGAAGGAGGATGGACCTGCGGGG + Intergenic
930972375 2:57411413-57411435 GGAAACACAATTCACCTACAAGG + Intergenic
931236125 2:60413835-60413857 GGTAAGAGAACGCACCTCCCTGG + Intergenic
931802514 2:65772473-65772495 GGAGAGCGAAAGCAACTGCAAGG - Intergenic
934778854 2:96956184-96956206 GGAAATCCAATGCTCCTGCATGG - Intronic
934792232 2:97071046-97071068 GAAAAGAGCATGCACTTGGAGGG + Intergenic
934814386 2:97312663-97312685 GAAAAGAGCATGCACTTGGAGGG - Intergenic
934823307 2:97395820-97395842 GAAAAGAGCATGCACTTGGAGGG + Intergenic
936859366 2:116998122-116998144 GAAATGAGAATGACCCTGCAAGG - Intergenic
936897464 2:117444863-117444885 GGCAAGAGAAAGCATGTGCAGGG - Intergenic
937033270 2:118758930-118758952 GGAGAGAGAGTGCACAGGCACGG - Intergenic
937283381 2:120735674-120735696 GGAAAGAAAACGCACCTACAAGG - Intronic
941263093 2:163321399-163321421 GGCAGGAGAATGAACCTGCGGGG + Intergenic
942199393 2:173555696-173555718 GGCAGGAGAATGCATTTGCAAGG + Intergenic
944498726 2:200335429-200335451 GGAAAGAGAAAGGACCTGGAGGG + Intronic
946106056 2:217370600-217370622 GGAATGAGATAGCACATGCAAGG - Intronic
946340311 2:219062256-219062278 AGAGGGACAATGCACCTGCATGG - Intergenic
946474044 2:219990869-219990891 GGAAAGAGAGAGCTCATGCAGGG - Intergenic
947124814 2:226856927-226856949 GGAAAGAGAATGTACTTCAATGG - Intronic
947968351 2:234301329-234301351 GGAAAGAAAATCCACCCGTATGG - Intergenic
948674015 2:239586691-239586713 AGTAAGAGGATGCACCTGCCCGG - Intergenic
1168827317 20:822707-822729 TGGATGAGAAGGCACCTGCAGGG + Intergenic
1171187607 20:23134032-23134054 GGAAATAAAATTCACCAGCAAGG + Intergenic
1172910366 20:38404517-38404539 GGAAATAGAATCCGCCAGCAAGG + Intergenic
1173136155 20:40440992-40441014 GGGAAAAGATTGCACCTTCAAGG - Intergenic
1173365440 20:42380616-42380638 GGAAAGAAAATGAGCCTGCTTGG + Intronic
1173649763 20:44655723-44655745 GGGTGGAGAGTGCACCTGCAGGG - Intergenic
1174075120 20:47929834-47929856 GGAAGGAGAAGGGACGTGCATGG + Intergenic
1175987217 20:62770138-62770160 GGGAAGGGGATGCACCTGTAAGG - Intergenic
1176114890 20:63427892-63427914 GGAAGGCGAATGCACCTGCCAGG - Intronic
1176864531 21:14038224-14038246 AGGAAGAGAATGCGACTGCAAGG - Intergenic
1177635474 21:23781961-23781983 GAAAAGAGAATGATCCTGAAAGG + Intergenic
1177946879 21:27481364-27481386 GGAACAAGATTTCACCTGCAGGG - Intergenic
1180065888 21:45412097-45412119 GGAAAGAGAATGCACCTGCAGGG - Intronic
1180860175 22:19074459-19074481 GGAAACGGAGTGCTCCTGCATGG + Intronic
1181100128 22:20533302-20533324 GGAAAGGGCAGGCATCTGCAGGG + Intronic
1183041798 22:35185360-35185382 GGAAAATGACTGCAACTGCAAGG + Intergenic
1183136774 22:35896521-35896543 GGAGAGTGAAAGTACCTGCATGG - Intronic
1183248337 22:36710940-36710962 GGACACAGAATGGCCCTGCATGG + Intergenic
949877549 3:8635994-8636016 GGACACAGAATACATCTGCAGGG + Intronic
950220995 3:11196039-11196061 GGAAAGAGAATGGACTTGGCGGG - Intronic
950309896 3:11948167-11948189 GCAAAGAGAATGCACCGACTTGG + Intergenic
950527582 3:13533367-13533389 GGAGACTGAAGGCACCTGCAAGG - Intergenic
950599324 3:14017794-14017816 GGAAGCAGATTGCTCCTGCAGGG - Intronic
950934633 3:16825937-16825959 GGAAAGAGGATGGGGCTGCAAGG + Intronic
951229300 3:20158168-20158190 GGAAGGAGAATTGACCTGAAAGG - Intergenic
953038309 3:39232724-39232746 GGAAAGAGCATGGACTTGGAGGG + Intergenic
953781575 3:45876118-45876140 GGAAAGAGAAAGCAAATGAATGG - Intronic
955376280 3:58399987-58400009 GAACAGAAAATGCACCTGAAGGG - Intronic
955948390 3:64217596-64217618 GGAAAGAGAATCAACTTCCAGGG + Intronic
956925364 3:73981413-73981435 GGAAGCAGAATGCCCCTGGAAGG - Intergenic
961530053 3:127535199-127535221 TGAAACAGAATAGACCTGCATGG + Intergenic
964404446 3:156334400-156334422 GGAAAGAGAAGGCCCTTCCAAGG - Intronic
964716284 3:159725735-159725757 TAAAAGACAATGCACCTGGATGG - Intronic
966761239 3:183420753-183420775 GGAGAGAGAGTGCTCATGCAGGG + Intronic
968036398 3:195551735-195551757 GGAAAGAGGCTGCACGTTCAGGG - Intergenic
969884889 4:10206591-10206613 GGAAAGAGAATGGTGTTGCACGG + Intergenic
970333754 4:15010105-15010127 GGAAAGTGAATGGAACTGGAAGG + Intronic
971079664 4:23195415-23195437 GGAAAGAGAAAGGTCCTTCATGG - Intergenic
971302902 4:25456514-25456536 GGAAAGAGGAAGCCCCTGCAGGG - Intergenic
971923895 4:32980993-32981015 GAAAAGAGAATGCTTATGCACGG - Intergenic
972095913 4:35346824-35346846 GGGAAGAGAATGCAGTTGCAGGG - Intergenic
972942224 4:44210172-44210194 AGAAAGAGAATACACTTTCAGGG - Intronic
975509670 4:75180657-75180679 GGAAGCAGATTGCTCCTGCAGGG + Intergenic
977898017 4:102385654-102385676 GGAAAGAGAATTTAGCTGGATGG - Intronic
981576675 4:146213128-146213150 GTAGAGAGAGCGCACCTGCATGG - Intergenic
982657129 4:158163772-158163794 AGAATCAGAATTCACCTGCAAGG + Intronic
984102608 4:175503242-175503264 AGAAAGAGAATGAAATTGCAGGG - Intergenic
985111401 4:186549977-186549999 GGAGAGAAAATGCATTTGCACGG - Intronic
985848431 5:2371222-2371244 GGAAAGGGATTCCACCTTCAAGG - Intergenic
986650023 5:9954087-9954109 AGAAGGAGGATGCAGCTGCAGGG + Intergenic
987577628 5:19751959-19751981 GGAAGCAGATTGCTCCTGCAGGG + Intronic
988674008 5:33412586-33412608 GCAAAGAGAATATACCAGCAGGG - Intergenic
990301127 5:54450614-54450636 GGAAAGAGACTGCACCTCCCAGG + Intergenic
990756881 5:59081987-59082009 GGAGAGAGTAAGCACCAGCAGGG - Intronic
990874790 5:60472488-60472510 GGAAAGAGAATCGAAGTGCAAGG - Intronic
991229278 5:64312030-64312052 GGAGAGAGAATGAAGCTGCTAGG + Intronic
991517831 5:67458920-67458942 AGAAACATAATGAACCTGCATGG - Intergenic
992192662 5:74309190-74309212 GGAAAAATAATGCACCTGGGAGG + Intergenic
992736463 5:79726778-79726800 GGAAGTTGAGTGCACCTGCAAGG + Intronic
992850626 5:80804181-80804203 GGAAAGATATTCCACATGCATGG - Intronic
994616289 5:102108105-102108127 GGAAAGAGAAAGCACATTGATGG - Intergenic
995119988 5:108526023-108526045 AGAAAGAGAATGCACCCCGAGGG + Intergenic
996289253 5:121832114-121832136 AGGAAGAGAATGCACCTCCAAGG + Intergenic
998204564 5:140149514-140149536 GGCAAGAGATAGCCCCTGCAAGG + Intergenic
999149685 5:149418443-149418465 GCAAAGAGCATGGACCTCCAGGG - Intergenic
999182823 5:149681906-149681928 ATAAAGAGACTGCACCTCCAGGG + Intergenic
1001094109 5:168762845-168762867 GGACAGGGAAGGCACCAGCAAGG - Intronic
1001521147 5:172394511-172394533 GAAAACAGAATACACCTACAGGG + Intronic
1001572797 5:172741634-172741656 GGAAAGAGAATGAGCCAACATGG + Intergenic
1003339019 6:5201987-5202009 TGAAAGAGGATGACCCTGCAGGG - Intronic
1005099561 6:22155683-22155705 GGGAAGTGAATGCAACAGCATGG + Intergenic
1006175568 6:32119388-32119410 GGAAAGAGTTTCCACCAGCATGG - Intronic
1006336145 6:33421399-33421421 GGCAAGGGAATACACCTGAAGGG - Intronic
1009775720 6:68203911-68203933 GAAAAAAAATTGCACCTGCAGGG - Intergenic
1010251568 6:73712770-73712792 GGAAGGAGAAAGCATCTGAAAGG + Intronic
1012045793 6:94271512-94271534 TAAAATAGAATGCACCTGGATGG + Intergenic
1012581214 6:100872620-100872642 GGAAGCAGATTGCTCCTGCAGGG + Intronic
1013428386 6:110034975-110034997 GGAAAGAGAAAGCCCCTGAGCGG + Intergenic
1013444874 6:110214482-110214504 GAAAAGAGAATGGATCAGCATGG + Intronic
1014833386 6:126128878-126128900 GAAAAGAAAATGCACCTAAAAGG + Intergenic
1015454236 6:133407394-133407416 GGAAAGAGTTTGCACCTGTAGGG - Intronic
1018485522 6:164237762-164237784 GGCAAGAGAAAACACGTGCAGGG - Intergenic
1021669657 7:23022652-23022674 GGGAAGAGAATGTCCCAGCAGGG + Intergenic
1022326923 7:29340934-29340956 GGTAGGAGAATGCAGCTGCTAGG + Intronic
1024191699 7:47018434-47018456 GGTAAGAGAAAGCATGTGCAGGG + Intergenic
1024213061 7:47223559-47223581 AGAAAGAGAATGCACCCCTAAGG + Intergenic
1024329205 7:48139674-48139696 GGAGAGAGAGGGCCCCTGCATGG + Intergenic
1028327819 7:89548910-89548932 GGAGAGAGAATGAACTTGTATGG - Intergenic
1029877310 7:103767902-103767924 GGAAAGAGCATACAGCTGGATGG - Intronic
1030233513 7:107233456-107233478 GGAAAGAGAAAGTAGTTGCAGGG - Intronic
1031623745 7:123968315-123968337 GGAAAGAGAAGGCAACTTCCAGG + Intronic
1032048492 7:128630670-128630692 AGAAAGAGAATGCACCCCTAAGG - Intergenic
1032384699 7:131513607-131513629 GGAATGAGACTGCACGTTCATGG - Intronic
1033504978 7:141990901-141990923 GGACAGAGAATACACATGCTGGG - Intronic
1034846649 7:154452215-154452237 GTAAAGACAATGCATGTGCAAGG + Intronic
1034846720 7:154452937-154452959 GAAAAGAGCATGGACCAGCAAGG - Intronic
1034897842 7:154888892-154888914 GCAAAGAGAAAGCATGTGCAGGG + Intronic
1036332483 8:7840929-7840951 GGATAGAGAATGCTAGTGCATGG - Intronic
1037158211 8:15732370-15732392 GGAAAGAGACAGCATGTGCAGGG - Intronic
1037182705 8:16026415-16026437 GGAAAGAGAGAGCATGTGCAGGG + Intergenic
1040421326 8:47242827-47242849 CCAAGGAGAGTGCACCTGCATGG - Intergenic
1040838505 8:51758654-51758676 GGAAGGAGAATGCATCTGGGAGG - Intronic
1044277675 8:90321540-90321562 GGAAAGACTCTGCACATGCAAGG + Intergenic
1045833554 8:106493304-106493326 GGAATGAGAAGACACCTGCAGGG - Intronic
1046942290 8:119943043-119943065 GGATAGAGAATGGATCTGGAAGG - Intronic
1048241168 8:132742948-132742970 GGAAAGAGAGAGCTCGTGCAGGG + Intronic
1048732788 8:137462497-137462519 GGAAACAGAAGGCACATGCAGGG + Intergenic
1049814336 8:144591165-144591187 GGACAGGGAAGGCACCTGCTGGG - Intronic
1049854808 8:144854616-144854638 AGAAAGAGACTGCATCTGTAAGG + Intergenic
1050845425 9:10211292-10211314 GGAAAAATAATGCATCTTCAAGG + Intronic
1051808593 9:21024698-21024720 GTGTAGAGAATGCACCTACAGGG - Intronic
1051856198 9:21568545-21568567 GGAAAGAGAATAAGCCTGCTTGG - Intergenic
1053461226 9:38272939-38272961 GGAAAGAGATTACACCTCAAAGG + Intergenic
1055157116 9:73077747-73077769 GAAAAGAGAATGAACCTGGAGGG + Intronic
1055703566 9:78973094-78973116 GGTAAGAGAGTTCACCTGCAAGG - Intergenic
1057746641 9:97757486-97757508 GGAAACAGAATGCACCCAGATGG - Intergenic
1057896616 9:98914003-98914025 AGATAGGGAAGGCACCTGCAGGG + Intergenic
1058509854 9:105705855-105705877 GAAAAGTTAATGCATCTGCAAGG + Intronic
1058922600 9:109631738-109631760 AGAAAGAGAATGCACCTCTAAGG + Intergenic
1058984938 9:110201477-110201499 GAAAAGAGAATGCACCAGCAGGG + Intronic
1186485240 X:9929577-9929599 CGAAAGAGAACTCACCTGCAGGG - Intronic
1186658890 X:11647531-11647553 AGAAAGAGAATCCAGCTGAAGGG + Intronic
1187043566 X:15623090-15623112 GGAAAGAAAATGCACTGGGATGG - Intergenic
1187543532 X:20224232-20224254 GGAAGGAGAGTGCACATGAATGG + Intronic
1187748258 X:22432979-22433001 GGAAACGGACTGCTCCTGCAGGG + Intergenic
1192278828 X:69662398-69662420 GGCAAGAGAAGGCATGTGCAGGG - Intronic
1192480462 X:71480868-71480890 GCAAAGAGAAAACACATGCAAGG + Intronic
1192981664 X:76350741-76350763 GGAAGGAGAAAACAGCTGCATGG + Intergenic
1194463282 X:94199211-94199233 GGAAAGAGAATGCAGCAGGTAGG - Intergenic
1194471498 X:94303058-94303080 GGAAGCAGATTGCTCCTGCAGGG - Intergenic
1195264979 X:103171462-103171484 GGGAAGAGACTGCTCCTCCAGGG + Intergenic
1199320342 X:146430758-146430780 GGAAAGAGGTAGGACCTGCATGG - Intergenic
1201906745 Y:19093189-19093211 GCAAAGAGAGTGCATGTGCAGGG - Intergenic