ID: 1180071035

View in Genome Browser
Species Human (GRCh38)
Location 21:45435916-45435938
Sequence GACCCCAGGGTGCATCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180071035_1180071047 28 Left 1180071035 21:45435916-45435938 CCTGTGAGATGCACCCTGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1180071047 21:45435967-45435989 GAGCTGTGGGTCCATGGCCCAGG 0: 1
1: 0
2: 3
3: 25
4: 360
1180071035_1180071043 14 Left 1180071035 21:45435916-45435938 CCTGTGAGATGCACCCTGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1180071043 21:45435953-45435975 TATCCTTCACAGCAGAGCTGTGG 0: 1
1: 0
2: 2
3: 18
4: 246
1180071035_1180071046 22 Left 1180071035 21:45435916-45435938 CCTGTGAGATGCACCCTGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1180071046 21:45435961-45435983 ACAGCAGAGCTGTGGGTCCATGG 0: 1
1: 1
2: 3
3: 27
4: 290
1180071035_1180071044 15 Left 1180071035 21:45435916-45435938 CCTGTGAGATGCACCCTGGGGTC 0: 1
1: 0
2: 0
3: 13
4: 122
Right 1180071044 21:45435954-45435976 ATCCTTCACAGCAGAGCTGTGGG 0: 1
1: 0
2: 0
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180071035 Original CRISPR GACCCCAGGGTGCATCTCAC AGG (reversed) Intronic
900313006 1:2043510-2043532 GACCCCAGGGTCCAGACCACTGG - Intergenic
900917420 1:5648593-5648615 GACCCCTGGGTAAAACTCACAGG - Intergenic
901447163 1:9315645-9315667 GAAACCAGGCTGCATCCCACAGG - Intronic
902602862 1:17551875-17551897 AACCCCAGGGAGCGGCTCACTGG + Intronic
904457454 1:30656250-30656272 GACACGAGGCTGCATCTAACTGG - Intergenic
906580721 1:46933494-46933516 GACACCAAGGTGCAACTCCCTGG - Intronic
908317269 1:62945318-62945340 TACACCATGGTGCATCTCAAAGG + Intergenic
912207505 1:107524634-107524656 GACTCCAGGGTGCAGTTCATGGG - Intergenic
914315498 1:146507687-146507709 GTCCCCAGGGACCATTTCACTGG + Intergenic
914498857 1:148225674-148225696 GTCCCCAGGGACCATTTCACTGG - Intergenic
918149066 1:181782689-181782711 GGCCCCAGATAGCATCTCACTGG + Intronic
920561276 1:206940416-206940438 GACTCCAGGGTTCACCTCCCTGG - Intronic
922753919 1:228083493-228083515 GACCCCAAATTGCGTCTCACTGG - Intronic
923040344 1:230315352-230315374 GACCGCCGGGTGCATATCCCAGG - Intergenic
924721338 1:246625899-246625921 GACCTCAGTTTTCATCTCACTGG + Intronic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1067692235 10:48509278-48509300 GACCCCATGGGGCATCGCTCAGG + Intronic
1069661746 10:70127635-70127657 GACCCCAGAGTGGACCTCAGGGG + Intronic
1070412560 10:76156280-76156302 GTGCCCAGGGTGCAGCTCCCAGG - Intronic
1071858398 10:89648349-89648371 GAAGCCAGGTGGCATCTCACAGG + Intergenic
1074116783 10:110462167-110462189 GACTCCAGGGAGCATCTCCCAGG + Intergenic
1075837858 10:125471275-125471297 GATCCCAGCGTGCCACTCACCGG - Intergenic
1076405852 10:130212207-130212229 GACCCCAGGGTGCAAGTAGCGGG + Intergenic
1076560538 10:131360442-131360464 GACCACTGGCTGGATCTCACTGG - Intergenic
1076859534 10:133134075-133134097 GACCCCAGGCTGCATCCCCCCGG + Intergenic
1077746834 11:4916018-4916040 GGCCCCTGGGTGCATCCCACTGG - Intronic
1081628632 11:44671899-44671921 GCCCCCATGGTTCCTCTCACGGG - Intergenic
1083988121 11:66230224-66230246 GACCCCTAGATGCATCTCCCTGG - Intronic
1084287793 11:68142991-68143013 GTCCCCAGGCTGCATCTCATTGG + Intergenic
1084500411 11:69531663-69531685 GAACCCAGGGTCCATTCCACTGG - Intergenic
1084666550 11:70579517-70579539 GGCCCCAGGTGGCATCTCCCAGG + Intronic
1089271309 11:117303280-117303302 GACCCCAGGCTGCAGCTCCCTGG - Intronic
1089645397 11:119875579-119875601 GACCCCAGGCTTCTCCTCACTGG - Intergenic
1097195975 12:57242687-57242709 CACCCCAGCCTGCCTCTCACTGG + Intergenic
1101785015 12:107874969-107874991 TACCCCAGAAGGCATCTCACGGG - Intergenic
1103573543 12:121860201-121860223 TGGCCCAGGGTGGATCTCACAGG + Intronic
1103940361 12:124498228-124498250 ACCCCCAGGCAGCATCTCACTGG - Intronic
1104031089 12:125066023-125066045 GACTCCAGGGAGCACCTCACAGG - Intronic
1107038308 13:35923160-35923182 GACCCCTGGGTGGATCTCCCAGG + Intronic
1108726852 13:53192227-53192249 GCCCCCAGGTTGCATCTCAGGGG + Intergenic
1113909225 13:113834295-113834317 GACCCCAGTGTGACACTCACGGG - Intronic
1114495144 14:23126964-23126986 CACCCCAGGGTCCATGTCCCAGG - Exonic
1119522652 14:75297341-75297363 GACCCCAGGGTGCCCAGCACAGG + Intergenic
1119659491 14:76440022-76440044 AAACCCTGGGTGCTTCTCACTGG + Intronic
1121582287 14:95039992-95040014 GACCACAGGGCTCATCTCATGGG - Intergenic
1123206995 14:106723517-106723539 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123212014 14:106770520-106770542 GAACCCAGGCTGCTTCTCAGTGG - Intergenic
1123981476 15:25608717-25608739 TTCCCCAGGGTGCAGCTAACTGG + Intergenic
1127039072 15:54953320-54953342 GACCCAAAGGAGCATCTCTCTGG - Intergenic
1128771306 15:70284462-70284484 GACCCAAGTGTGGATCTCGCTGG - Intergenic
1130920442 15:88339549-88339571 GAACCCAGCGTCCTTCTCACTGG - Intergenic
1131305452 15:91239125-91239147 GACCCCATGGGGCATTTCAAAGG - Intronic
1134762983 16:16730503-16730525 GCACCTTGGGTGCATCTCACTGG + Intergenic
1134983069 16:18628646-18628668 GCACCTTGGGTGCATCTCACTGG - Intergenic
1135734379 16:24919075-24919097 GACTCCCGGGGGCAGCTCACAGG - Intergenic
1136398654 16:30006207-30006229 GGCCGCAGGGGGCAGCTCACTGG + Exonic
1136608904 16:31354587-31354609 GACCACAGGGTGCCTCACCCGGG - Intergenic
1136772002 16:32848191-32848213 GAACCCAGGCTGCGTCTCAGTGG + Intergenic
1136898608 16:34013330-34013352 GAACCCAGGCTGCGTCTCAGTGG - Intergenic
1137018029 16:35395114-35395136 GAACCCCAGGTGCACCTCACAGG + Intergenic
1141289281 16:82702799-82702821 GCCCCCAGGGTTCAGCTCCCTGG + Intronic
1203074423 16_KI270728v1_random:1110280-1110302 GAACCCAGGCTGCGTCTCAGTGG + Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1146264982 17:31446772-31446794 GACACCAGGGGGCATCTTCCTGG + Intronic
1146281958 17:31550312-31550334 GACTCCAGGGTCCACCTTACAGG + Intergenic
1148232429 17:45944761-45944783 GACCCAAGGGTGCCTCTGAGAGG + Intronic
1148455628 17:47809571-47809593 GACCCCAGGGTTCCTGTCACAGG - Intronic
1152238615 17:79150794-79150816 GGCCACAGGGTGCCTCTGACTGG + Intronic
1152797430 17:82315131-82315153 GGCCCCACGGTGCTTCTCAGTGG - Exonic
1160378059 18:78429232-78429254 GTCTCCAGGGTGCAGCTCCCAGG + Intergenic
1161154218 19:2723802-2723824 GTCCCCAGGGTGAAACCCACCGG + Intronic
1163512167 19:17741771-17741793 CACCTCAGGGTGCATCTGACTGG - Intergenic
1165579706 19:36851388-36851410 GACCCCAAGGTGTATGTCACTGG + Exonic
925131803 2:1499082-1499104 GACCCCAAAGTGCTACTCACAGG + Intronic
927855272 2:26523808-26523830 GACCCCAGGCTCCTTCTCATGGG - Intronic
928759208 2:34561341-34561363 GAGGCCTGGGTTCATCTCACTGG - Intergenic
933597766 2:84299883-84299905 GATCTCAGGGTGCATAACACAGG + Intergenic
933984719 2:87581083-87581105 GAGCCCAGGGTGCATCACCATGG - Intergenic
935212118 2:100947021-100947043 GTCCCCAGGGAGCATCTGAGTGG + Intronic
935329242 2:101964424-101964446 GGCACCAGGGTGCAGCTAACTGG + Intergenic
936309132 2:111369717-111369739 GAGCCCAGGGTGCATCACCATGG + Intergenic
936865713 2:117074223-117074245 GACCCCACACTGCACCTCACAGG - Intergenic
947139055 2:227004304-227004326 GACCCCAGGGAGGACATCACTGG + Exonic
1168949629 20:1787814-1787836 AACCCCACTGAGCATCTCACTGG + Intergenic
1169075667 20:2758654-2758676 GACCCCAGGCTCCTTCTCCCAGG - Intronic
1172138323 20:32703273-32703295 GGCCCCATGGAGCATCCCACAGG + Exonic
1175400380 20:58696824-58696846 GACAACAGGATGTATCTCACAGG - Intronic
1176096236 20:63345765-63345787 GAGCCCAGGGCGGATCTCCCGGG + Exonic
1179179479 21:39033326-39033348 GTCCCCAGGGCTCATCTCCCTGG + Intergenic
1179962069 21:44773143-44773165 GATCTTAGGGTGCATCCCACTGG + Intronic
1180071035 21:45435916-45435938 GACCCCAGGGTGCATCTCACAGG - Intronic
1180092700 21:45541280-45541302 GGAGCCAGGCTGCATCTCACTGG - Intronic
1181141777 22:20810746-20810768 CACCTCAGGGTGCCTCTGACTGG - Intronic
1181265485 22:21628626-21628648 TACCCCAGTGTGCCTCCCACCGG - Exonic
1182620173 22:31614509-31614531 GTCGCCAGGGTCCATGTCACAGG - Intronic
1184987816 22:48147406-48147428 GACCCCAGGATCCAGCTCAATGG + Intergenic
949940376 3:9150069-9150091 TATCCCAGTGTTCATCTCACTGG - Intronic
954220871 3:49153187-49153209 GACCCCAGGGTTCAGGTCCCTGG - Intergenic
954384825 3:50238495-50238517 GACCCCAGGGTGAACTTCCCAGG - Intronic
954580974 3:51702785-51702807 AACCCCTGGGTTCATCTCCCTGG - Intronic
954670895 3:52290838-52290860 GGCCCCAGGATGCATGTCAGTGG + Intronic
960449637 3:117790570-117790592 GACCCCTGTGTGGGTCTCACTGG + Intergenic
961716631 3:128861947-128861969 AAGCCCAGGGTGGTTCTCACAGG - Intergenic
961719036 3:128879939-128879961 GGCCGCAGGGTGTATCTCTCTGG - Intronic
961805063 3:129483438-129483460 AAGCCCAGGGTGGTTCTCACAGG + Intronic
968912239 4:3482296-3482318 GACCCCAGGCAGCACCTCATGGG - Intronic
969259852 4:6026450-6026472 GACCCCAGGATGCGTTTCCCAGG - Intronic
969296880 4:6275531-6275553 CACCCCCGGGTGCATCCCCCAGG - Intronic
969713914 4:8859464-8859486 GCCCCCAGGCTGCACCTCAGAGG - Intronic
985513136 5:323066-323088 GACTCCTGGGTGCTGCTCACGGG - Intronic
990209279 5:53464867-53464889 GCCCCCTGTGTGCATCTGACAGG - Intergenic
992677828 5:79123384-79123406 GACCCCAGTGTTCAGCTCCCAGG - Intronic
997421974 5:133776655-133776677 GTCCCCAGAGTGCCTCTCATGGG - Intergenic
998652936 5:144141747-144141769 TTCCCCAGGTTGCATTTCACTGG + Intergenic
1006518635 6:34558719-34558741 GGCCCAAGGGAGCATTTCACAGG + Intergenic
1007423140 6:41731633-41731655 GACCCCACTGTGCCTCTCACTGG - Intronic
1010391430 6:75342688-75342710 GACCACAGTGTGCATCTCAGAGG - Intronic
1019917021 7:4140174-4140196 CACCCCAGCCTGCACCTCACAGG + Intronic
1020001545 7:4759111-4759133 GACCCCAGAGTGCCTGTCTCGGG + Exonic
1032790544 7:135239296-135239318 GAACCCAGCGTGCAGCTCCCAGG - Intronic
1032959205 7:137011306-137011328 GACCCCAGGATGCATGGCTCAGG + Intronic
1035133256 7:156675315-156675337 GAGACGAGGGTGCCTCTCACAGG + Intronic
1040289980 8:46119300-46119322 GTCCCCAGGGTGTCTCTCGCAGG - Intergenic
1048840793 8:138564170-138564192 GGAGCCAGGGAGCATCTCACTGG + Intergenic
1055470749 9:76607964-76607986 GACCCAGGGCTGCATGTCACTGG - Intergenic
1056664609 9:88571772-88571794 AACACCTGGGGGCATCTCACTGG + Intronic
1060509483 9:124221701-124221723 GACCCCTGAGGGCATGTCACAGG + Intergenic
1060525166 9:124316341-124316363 GACACCAGGGTGCAGCCCAGTGG + Intronic
1061807233 9:133143276-133143298 GAAGCCAGGGTGCTTCCCACAGG + Intronic
1061989384 9:134150143-134150165 GACCACAGAGGGCAACTCACTGG + Intronic
1062138003 9:134939842-134939864 GGCCCCGGGGAGCATCTCGCAGG - Intergenic
1187305086 X:18087756-18087778 GACCTCAGGGTCCAGCTCAGAGG + Intergenic
1187956719 X:24525815-24525837 GACCCCAGGGGGAATTCCACGGG - Intronic
1192441686 X:71179258-71179280 GACCCCAGAGTGCCTCTGAATGG - Intergenic
1197119971 X:122879673-122879695 GTCCTTAGGGTGCATCCCACTGG - Intergenic
1197837013 X:130705740-130705762 CACCCCAGGGTGCAGGTCAGTGG - Intronic