ID: 1180072597

View in Genome Browser
Species Human (GRCh38)
Location 21:45443772-45443794
Sequence CCTTTACGCGGCTCTGCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180072586_1180072597 25 Left 1180072586 21:45443724-45443746 CCAATTTCCTGGTGAAGAGTCTT 0: 1
1: 0
2: 0
3: 25
4: 196
Right 1180072597 21:45443772-45443794 CCTTTACGCGGCTCTGCTGGTGG 0: 1
1: 0
2: 0
3: 2
4: 48
1180072587_1180072597 18 Left 1180072587 21:45443731-45443753 CCTGGTGAAGAGTCTTTATGAGA 0: 1
1: 0
2: 1
3: 6
4: 125
Right 1180072597 21:45443772-45443794 CCTTTACGCGGCTCTGCTGGTGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180072597 Original CRISPR CCTTTACGCGGCTCTGCTGG TGG Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
905037421 1:34927238-34927260 CCTGTACTCAGCTCTGATGGGGG + Intronic
912385759 1:109270476-109270498 CTTTTCCTGGGCTCTGCTGGAGG + Exonic
914350734 1:146837598-146837620 CCTTAATGGGGGTCTGCTGGTGG + Intergenic
922620634 1:226986007-226986029 CCTCTCCCCTGCTCTGCTGGCGG + Intronic
1063454682 10:6174725-6174747 CCCTCCCACGGCTCTGCTGGGGG + Intronic
1086080996 11:82901816-82901838 CCTTTACCCAGCTCACCTGGGGG - Exonic
1091280113 11:134376873-134376895 CCTTGACCCGGCTCAGCTGCTGG - Intronic
1115474601 14:33800751-33800773 CCTCTGCGCGGCCGTGCTGGTGG - Exonic
1121109707 14:91303747-91303769 TCTTTAGGCAGCTGTGCTGGCGG + Exonic
1125501580 15:40242961-40242983 CCTTTCCACTGCTCTGCTGCAGG - Intronic
1138223630 16:55274265-55274287 CCTTTTTGTGGCTCTGCTGGAGG - Intergenic
1139983301 16:70877946-70877968 CCTTAATGGGGGTCTGCTGGTGG - Intronic
1140823245 16:78682428-78682450 CCTTTAGCCGGGTCTGGTGGTGG + Intronic
1142187311 16:88700777-88700799 CCCTTACGCTGCTCTGATGTGGG + Intronic
1149319946 17:55472494-55472516 CCTTAAGGCTGCTCTGCTGCCGG + Intergenic
1150431749 17:65123601-65123623 AATTTCCGAGGCTCTGCTGGTGG - Intergenic
1152783387 17:82236257-82236279 CCTGTCCGGGGCTCTGCTGGCGG + Intronic
1162123203 19:8485117-8485139 CCTCTAGGATGCTCTGCTGGGGG - Intronic
1164732174 19:30514588-30514610 ACTTTATGCAGCTCTTCTGGTGG + Intronic
1167145543 19:47679479-47679501 CCTCTTGGAGGCTCTGCTGGAGG - Exonic
925844533 2:8023593-8023615 CATTTACTCTGCTGTGCTGGTGG - Intergenic
929782461 2:44965917-44965939 CCTTTTGGGGGCCCTGCTGGAGG - Intergenic
937439688 2:121905424-121905446 CCCTTACGGGGATCTGCAGGTGG + Intergenic
942144891 2:173017483-173017505 CCTATCCGCGGCTCTGATGAAGG + Exonic
944264094 2:197705591-197705613 CCTGTACTCGGCACTACTGGCGG + Exonic
1173764049 20:45589884-45589906 ATTTTACCAGGCTCTGCTGGGGG + Intergenic
1176005723 20:62861421-62861443 CCTCAACTCGGCGCTGCTGGCGG - Exonic
1176256390 20:64155234-64155256 CCCTCCCGGGGCTCTGCTGGGGG + Intronic
1179249449 21:39660855-39660877 CGTTTCCGCTGCACTGCTGGTGG - Exonic
1179442118 21:41402503-41402525 GCCTTACGCGGCTGTGTTGGTGG - Intronic
1180072597 21:45443772-45443794 CCTTTACGCGGCTCTGCTGGTGG + Intronic
1184959797 22:47920741-47920763 CCTTTCCCAGCCTCTGCTGGAGG + Intergenic
954612962 3:51955931-51955953 CCTCTCCGCCGCTCTGCTGCCGG + Exonic
957045958 3:75374739-75374761 CCTTTACGGGGGTCGGGTGGGGG + Intergenic
960950335 3:122994951-122994973 CCTTTAAGCAGCTCACCTGGAGG - Intronic
961586955 3:127938019-127938041 CCTTTATGGTGGTCTGCTGGTGG - Intronic
962374622 3:134849859-134849881 CCTTTACTGGGCTGGGCTGGGGG + Intronic
969591381 4:8123662-8123684 CCTTAAAGCGGGTCTCCTGGGGG + Intronic
970600267 4:17636557-17636579 CCTTCAGGCGGGTCTGCAGGCGG + Exonic
989178865 5:38556666-38556688 CCTGCACGCCGCTCGGCTGGGGG + Intronic
995833949 5:116381931-116381953 CCTTTGCGAGGCAGTGCTGGAGG + Intronic
1006902555 6:37512556-37512578 GCTTTACACGGCTCTGCCTGCGG + Intergenic
1018364150 6:163100556-163100578 TCTTTAAGCAGTTCTGCTGGCGG + Intronic
1022914384 7:34933237-34933259 ACTTTACACTGCTCTGGTGGTGG - Intronic
1035426705 7:158782952-158782974 CCTTTATCGGGCCCTGCTGGTGG - Intronic
1059368700 9:113807655-113807677 CCTTTACCGGGGTGTGCTGGGGG - Intergenic
1186285589 X:8040610-8040632 TCTTTAAGAGGCTCTGCTTGAGG - Intergenic
1192589783 X:72350367-72350389 CATTTACTGGGCTCTGCTAGTGG + Intronic
1198231615 X:134695281-134695303 CCTTTATTTGGCTGTGCTGGGGG + Intronic