ID: 1180075729

View in Genome Browser
Species Human (GRCh38)
Location 21:45460526-45460548
Sequence GATGAAGGAGCAGCCCCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 359}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180075729_1180075745 29 Left 1180075729 21:45460526-45460548 CCCCGAGGGGCTGCTCCTTCATC 0: 1
1: 0
2: 0
3: 15
4: 359
Right 1180075745 21:45460578-45460600 GGCACACAGGTGTCCTTATATGG 0: 1
1: 0
2: 1
3: 10
4: 91
1180075729_1180075738 8 Left 1180075729 21:45460526-45460548 CCCCGAGGGGCTGCTCCTTCATC 0: 1
1: 0
2: 0
3: 15
4: 359
Right 1180075738 21:45460557-45460579 CTACCCCATGGGCCAGCCACTGG 0: 1
1: 0
2: 1
3: 11
4: 146
1180075729_1180075734 -3 Left 1180075729 21:45460526-45460548 CCCCGAGGGGCTGCTCCTTCATC 0: 1
1: 0
2: 0
3: 15
4: 359
Right 1180075734 21:45460546-45460568 ATCGCTCCTCCCTACCCCATGGG 0: 1
1: 0
2: 0
3: 6
4: 104
1180075729_1180075742 16 Left 1180075729 21:45460526-45460548 CCCCGAGGGGCTGCTCCTTCATC 0: 1
1: 0
2: 0
3: 15
4: 359
Right 1180075742 21:45460565-45460587 TGGGCCAGCCACTGGCACACAGG 0: 1
1: 0
2: 4
3: 19
4: 260
1180075729_1180075733 -4 Left 1180075729 21:45460526-45460548 CCCCGAGGGGCTGCTCCTTCATC 0: 1
1: 0
2: 0
3: 15
4: 359
Right 1180075733 21:45460545-45460567 CATCGCTCCTCCCTACCCCATGG 0: 1
1: 0
2: 0
3: 24
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180075729 Original CRISPR GATGAAGGAGCAGCCCCTCG GGG (reversed) Intronic
900931932 1:5743253-5743275 GAGGAGGGGGCAGCCCCTCCAGG - Intergenic
900988643 1:6087404-6087426 GATGAAGGAGGACCCCCCAGGGG + Intronic
903038045 1:20507582-20507604 GATGAAAGTCCATCCCCTCGTGG - Intronic
903595526 1:24490989-24491011 AATGAAGCCGCAGACCCTCGTGG - Intergenic
905183010 1:36178167-36178189 CCAGAAGGAGCAGCCCCCCGCGG + Exonic
907275681 1:53315462-53315484 GAGGATGGAGCCGCCCCTCAAGG - Intronic
907405597 1:54251733-54251755 GAGGGAGGAGGAGCCCCTCCTGG + Intronic
907842005 1:58167686-58167708 AATGAAGCCGCAGACCCTCGTGG - Intronic
907843071 1:58175168-58175190 AATGAAGCTGCAGACCCTCGTGG - Intronic
909904392 1:81177826-81177848 AATGAAGCCGCAGACCCTCGCGG + Intergenic
911298176 1:96142735-96142757 AATGAAGCCGCAGACCCTCGTGG - Intergenic
912082790 1:105958244-105958266 AATGAAGCTGCAGACCCTCGGGG + Intergenic
912316099 1:108668658-108668680 AATGAAGCAGCGGACCCTCGCGG - Intergenic
913176386 1:116276748-116276770 GATGAACAGGCAGCCCCTGGAGG - Intergenic
913470375 1:119180329-119180351 AATGAAGCCGCAGACCCTCGCGG - Intergenic
915104302 1:153522924-153522946 AATGAAGCCGCAGACCCTCGCGG - Intergenic
916114138 1:161473152-161473174 AATGAAGCCGCAGACCCTCGTGG - Intergenic
917446135 1:175107148-175107170 GATGAAGCCGCAAACCCTCGTGG + Intronic
917840817 1:178976036-178976058 AATGAAGCTGCAGACCCTCGTGG - Intergenic
917860587 1:179139459-179139481 AATGAAGCCGCAGACCCTCGCGG - Intronic
917975220 1:180233751-180233773 GGAGAAGGAGGAGCCCCGCGGGG + Intronic
918795944 1:188897167-188897189 AATGAAGCTGCAGACCCTCGTGG + Intergenic
918952145 1:191152329-191152351 AATGAAGCTGCAGACCCTCGTGG - Intergenic
919085168 1:192912313-192912335 AATGAAGCCGCAGACCCTCGCGG - Intergenic
919201204 1:194357685-194357707 AATGAAGCCGCAGACCCTCGCGG + Intergenic
919297592 1:195722013-195722035 AATGAAGCCGCAGACCCTCGTGG + Intergenic
919727061 1:200891364-200891386 GCTGCGGGAGCAGCCGCTCGAGG - Intronic
920656162 1:207876893-207876915 GATGAAGGAGCATCCCAGCTAGG + Intergenic
921046181 1:211479396-211479418 GATGCACGGGCAGCCCCTCGGGG - Intronic
921743850 1:218715499-218715521 AATGAAGCTGCAGCCCCTCGTGG + Intergenic
922704222 1:227780538-227780560 GATGAAGGGGCTGGCCCTGGAGG + Exonic
923163300 1:231336847-231336869 GAGGAGGCAGCGGCCCCTCGAGG - Exonic
923265893 1:232313890-232313912 AATGAAGCTGCAGACCCTCGCGG + Intergenic
924117701 1:240763631-240763653 AATGAAGCCGCAGACCCTCGCGG - Intergenic
924219059 1:241854760-241854782 AATGAAGCCGCAGACCCTCGCGG + Intronic
924505726 1:244681911-244681933 AATGAAGCCGCAGACCCTCGTGG + Intronic
1063272135 10:4522219-4522241 GATGGAAGAGCAGCCCCGCCTGG - Intergenic
1065896066 10:30163995-30164017 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1065965655 10:30768407-30768429 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1068368452 10:56083136-56083158 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1068500014 10:57833087-57833109 AATGAAGCTGCAGACCCTCGCGG - Intergenic
1069364563 10:67683920-67683942 AATGAAGCCGCAGACCCTCGTGG + Intronic
1069551652 10:69368431-69368453 GATGAAGCAGAAGCCCATAGGGG - Intronic
1070563930 10:77589604-77589626 AATGAAGCCGCAGACCCTCGCGG + Intronic
1070710217 10:78675832-78675854 GAGGAAGGAGCAGTCTCTCTGGG - Intergenic
1071055467 10:81503985-81504007 AATGAAGCCGCAGACCCTCGTGG - Intergenic
1075420035 10:122293942-122293964 GATGAAGAAGCTGCCCTTCTTGG - Intronic
1075566943 10:123511914-123511936 GAGGCAGGTGCAGCCCCTCCAGG + Intergenic
1076706491 10:132304856-132304878 GATGAAGGCAAAGCCCCTCAGGG + Intronic
1076797925 10:132807795-132807817 GCTGAAGAAACAGCCCCACGCGG + Intergenic
1077363873 11:2153667-2153689 GAGGGAGGAGCAGCTCCTCGAGG - Intronic
1078891502 11:15562070-15562092 AATGAAGCCGCAGACCCTCGAGG - Intergenic
1082757216 11:57089719-57089741 TAGGCAGGAGCAGCCCCTTGTGG + Intergenic
1082934192 11:58639389-58639411 GAAAAAGGAGGAGCCCCTAGAGG - Intergenic
1083757972 11:64801658-64801680 GAGGGAGGAGGAGGCCCTCGGGG - Intronic
1083804571 11:65066340-65066362 GCTGAAGGAGCGGCCTCCCGAGG + Intronic
1084552994 11:69859733-69859755 AATGAAGCAGCAGACCTTCGTGG - Intergenic
1084598919 11:70133406-70133428 GACCAAGGAGCAGCTGCTCGGGG + Intronic
1085471804 11:76763305-76763327 GATGACGGAACAGCCCCTGTAGG + Intergenic
1086484591 11:87285348-87285370 AATGAAGCTGCAGACCCTCGCGG + Intronic
1087253010 11:95924267-95924289 GATGAAGGACCAGACCCTTATGG + Exonic
1087354722 11:97077919-97077941 AATGAAGCTGCAGACCCTCGCGG - Intergenic
1087486188 11:98762424-98762446 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1087882011 11:103427727-103427749 GAGAATGGAGCAGCCCCTCGTGG - Intronic
1089244560 11:117109661-117109683 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1091109222 11:132950068-132950090 GATGAAGGTGCAGCCGCGCTGGG + Intronic
1094000342 12:25687716-25687738 AATGAAGCCGCAGACCCTCGTGG - Intergenic
1094661474 12:32473591-32473613 AATGAAGCCGCAGACCCTCGCGG - Intronic
1094736483 12:33240501-33240523 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1095956470 12:47809177-47809199 GGAGAAGGAGCCGCCCCTAGAGG - Intronic
1097414325 12:59295737-59295759 AATGAAGCCGCAGACCCTCGTGG - Intergenic
1098790330 12:74814853-74814875 AATGAAGCTGCAGGCCCTCGCGG - Intergenic
1099523735 12:83695116-83695138 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1100246114 12:92758490-92758512 GCTGGAGGAGCAGCTCCTGGTGG + Intronic
1100600833 12:96110264-96110286 GATGAAGCCGCGGACCCTCGCGG - Intergenic
1101731880 12:107433509-107433531 GAGGAAGGAGCAGCCCCCATGGG + Intronic
1103897318 12:124281355-124281377 GCTAAAGGAGCAGTCCCTCTTGG - Intronic
1107590262 13:41897611-41897633 AATGAAGCCGCAGACCCTCGCGG + Intronic
1108118855 13:47161066-47161088 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1108118883 13:47161302-47161324 AATGAAGCTGCAGACCCTCGTGG + Intergenic
1109151960 13:58858194-58858216 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1109202064 13:59441505-59441527 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1109464556 13:62712478-62712500 AATGAAGCTGCAGACCCTCGTGG - Intergenic
1109829792 13:67772013-67772035 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1110369058 13:74719607-74719629 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1110854027 13:80277793-80277815 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1111096182 13:83517865-83517887 AATGAAGCAGCAGACCCTCGTGG - Intergenic
1111239904 13:85459827-85459849 AATGAAGCAGCAGACCCTCGTGG - Intergenic
1111591211 13:90349713-90349735 AATGAAGGCGCGGACCCTCGCGG - Intergenic
1113338424 13:109399190-109399212 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1113550471 13:111189264-111189286 AATGAAGCCGCAGACCCTCGCGG + Intronic
1113550494 13:111189499-111189521 AATGAAGCTGCAGACCCTCGTGG + Intronic
1114679745 14:24474459-24474481 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1115533092 14:34345079-34345101 AATGAAGCCGCAGACCCTCGCGG + Intronic
1116014349 14:39388566-39388588 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1116151955 14:41153486-41153508 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1116250856 14:42481615-42481637 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1118215219 14:63802652-63802674 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1118389310 14:65282779-65282801 GAGGAAGGAGCAAGCCCTGGTGG + Intergenic
1120397665 14:83988394-83988416 GAAGAAGGAGCACCCCCAGGAGG - Intergenic
1120986841 14:90342596-90342618 GATGAAAGAGCAGCACCCCCAGG + Intergenic
1122478816 14:102032282-102032304 GATCAAGAAGCAGCACCTGGTGG + Exonic
1122600309 14:102918045-102918067 GAGGAAGGAGCCGCCACTGGGGG - Intergenic
1123003834 14:105311956-105311978 GCTGAGGAAGCAGCCCCACGTGG - Exonic
1123194676 14:106605088-106605110 GAGGGAGGAGCAGCCCCCTGAGG - Intergenic
1123825417 15:24077632-24077654 AATGAAGCAGCAGACCCTCACGG + Intergenic
1124920212 15:34018547-34018569 AATGAAGCCGCAGACCCTCGTGG + Intronic
1126348235 15:47718350-47718372 GAGGCCGGAGCAGCCCCTCGCGG + Intronic
1127238184 15:57079642-57079664 GGTGAATGAGTAGCCCCTGGCGG + Intronic
1127672778 15:61211815-61211837 GATGATGTTGCAGCCCATCGAGG - Intronic
1128598395 15:68974811-68974833 AATGAAGCCGCAGACCCTCGTGG + Intronic
1131012538 15:89030941-89030963 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1131912715 15:97225027-97225049 GATGAAACCGCAGACCCTCGCGG - Intergenic
1133255029 16:4511522-4511544 GAGGAAGGAGCAGCCACAAGTGG - Exonic
1135224474 16:20643527-20643549 AATGAAGCTGCAGACCCTCGTGG + Intronic
1136511035 16:30738462-30738484 GATGAAGGAGCAGCTTCACAGGG - Exonic
1137036512 16:35574026-35574048 GTTGAAGGAACTGCCCCTCCTGG + Intergenic
1137945848 16:52732531-52732553 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1141757306 16:85999920-85999942 GACCAAGGGGCAGCCCCTGGTGG + Intergenic
1142153385 16:88522439-88522461 GATGACCAAGCAGCCCCACGGGG + Intronic
1203139788 16_KI270728v1_random:1754679-1754701 TATGCAGGAGCAGCCCCGGGTGG - Intergenic
1142505826 17:362633-362655 AATGAAGCCGCAGACCCTCGCGG - Intronic
1144710809 17:17400385-17400407 GTTGAAGCAGCAGCCCATCAAGG - Intergenic
1145058436 17:19717670-19717692 GAGGAAGGAGCAGACCCTGAAGG + Intronic
1146399516 17:32492171-32492193 GAGGAAGCAGCAGCTCCTCCTGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148023564 17:44569415-44569437 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1148086292 17:44995683-44995705 GACGAAGGAGCAGCTGCTCTGGG + Intergenic
1148200958 17:45749787-45749809 GATGAGGCAGCAGCCCCGCTAGG + Intergenic
1149609329 17:57948607-57948629 GATGAAGTAGAGGCCCCTAGAGG - Intronic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150682704 17:67296074-67296096 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1151390471 17:73783788-73783810 GCTCAAGGTGCAGCCCCTCTGGG - Intergenic
1154954516 18:21241887-21241909 GACGAACGCGCAGCCCCGCGGGG - Intergenic
1155611535 18:27673001-27673023 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1156150112 18:34231480-34231502 GAAGATGGAACAGCTCCTCGAGG + Intergenic
1157453172 18:47802976-47802998 GATGATGGAGCAGCTCCCCTGGG + Intergenic
1158282150 18:55839924-55839946 AATGAAGCTGCAGACCCTCGTGG + Intergenic
1160198749 18:76778662-76778684 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1161305288 19:3564061-3564083 GATGAAAGCTCAGGCCCTCGGGG + Intronic
1162232914 19:9282513-9282535 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1163521513 19:17794816-17794838 GATGAACAAGCAGCGCCTTGCGG - Intronic
1164156946 19:22602823-22602845 GCTGAAGGAGCAGCACCGAGAGG + Intergenic
1164160706 19:22623876-22623898 GCCGAAGGTGCCGCCCCTCGGGG - Intergenic
1165080061 19:33301916-33301938 GATCAAGCAGGAGCCCCGCGAGG - Exonic
1165168427 19:33872939-33872961 GATGAAGGGGCAGACCCTAAAGG + Intergenic
1165898878 19:39159282-39159304 AATGAACGGGCAGCCCCACGAGG - Intronic
1166117100 19:40662924-40662946 GGTGAAGCAGCGCCCCCTCGTGG - Intergenic
1167760770 19:51447162-51447184 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1168324247 19:55530056-55530078 GCTGAATGGGCAGGCCCTCGGGG + Exonic
1168428199 19:56256707-56256729 GATATAGGGGCAGCCCCTGGTGG + Intronic
925537631 2:4934492-4934514 AATGAAGCCGCAGACCCTCGCGG + Intergenic
926156061 2:10454603-10454625 GGTGAAGTAGCAGCCCCTGGGGG - Intergenic
928648579 2:33381626-33381648 AATGATGGAGCTGCCCCTGGTGG + Intronic
928753366 2:34495438-34495460 AATGAAGCCGCAGACCCTCGTGG - Intergenic
928880741 2:36093388-36093410 AATGAAGCTGCAGACCCTCGCGG - Intergenic
931920356 2:67008632-67008654 AAGGAAGGAGCTGCCCCTCCAGG + Intergenic
932848498 2:75158906-75158928 GATGAAGAAGCAGATGCTCGAGG - Intronic
936347079 2:111683189-111683211 AATGAAGCCGCAGACCCTCGCGG - Intergenic
936865233 2:117070662-117070684 AATGAAGGCGCAGACCTTCGTGG + Intergenic
937454423 2:122029061-122029083 GATGAAGGAGCTGCTTCTTGGGG + Intergenic
938212881 2:129483376-129483398 GATGAAGGAGTTGCCCCTCAAGG + Intergenic
938401206 2:130992636-130992658 AATGAAGCCGCAGACCCTCGCGG - Intronic
938422416 2:131155496-131155518 GCTGAGGGTCCAGCCCCTCGAGG + Intronic
939281926 2:140074861-140074883 AATGAAGCCGCAGACCCTCGTGG - Intergenic
939738595 2:145880125-145880147 AATGAAGCCGCAGACCCTCGCGG + Intergenic
939777171 2:146402756-146402778 AATGAAGCCGCAGACCCTCGCGG + Intergenic
940892603 2:159049456-159049478 GATGATGAAGCAGTCCCTCATGG - Intronic
941243933 2:163073265-163073287 AATGAAGCTGCAGACCCTCGCGG - Intergenic
941537881 2:166743945-166743967 AATGAAGCCGCAGACCCTCGTGG + Intergenic
943105980 2:183545843-183545865 AATGAAGCCGCAGACCCTCGTGG + Intergenic
943294238 2:186116715-186116737 AATGAAGCCGCAGACCCTCGCGG + Intergenic
943744609 2:191448601-191448623 AATGAAGCCGCAGACCCTCGCGG - Intergenic
943855047 2:192778792-192778814 AATGAAGCTGCAGACCCTCGCGG + Intergenic
944053119 2:195493870-195493892 AATGAAGACGCAGACCCTCGTGG - Intergenic
946357907 2:219200490-219200512 AATGAAGCCGCAGACCCTCGCGG + Intronic
948809274 2:240466589-240466611 GCCGCAGAAGCAGCCCCTCGAGG + Exonic
1169074292 20:2751874-2751896 GACGGAGGGGCAGCCCCTGGGGG - Intronic
1169485245 20:6025018-6025040 GATGAAGCAGCAGGCACTAGTGG + Intronic
1169693497 20:8360144-8360166 GATGCAGGAGAAGCAACTCGAGG - Intronic
1171386461 20:24772614-24772636 GATGAAGGAGCAGTGGCTGGGGG - Intergenic
1171973252 20:31577761-31577783 AATGAAGCTGCAGACCCTCGCGG + Intronic
1172092446 20:32443559-32443581 CATGAAGGAGCTGCCCCCAGAGG + Exonic
1173529521 20:43758292-43758314 GAGGAAGGAGGAGCCCATCAGGG - Intergenic
1173778992 20:45737484-45737506 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1173872339 20:46350014-46350036 GATGAAGCTCCAGCCCCTGGAGG + Exonic
1174287379 20:49482840-49482862 GAGGGAGGGGCCGCCCCTCGGGG + Intergenic
1175457651 20:59127453-59127475 CAGGAAGGTGCAGGCCCTCGAGG - Intergenic
1175540541 20:59745039-59745061 GATCACGGAGCAGGCCCTGGGGG + Intronic
1176724009 21:10414852-10414874 GATGAAGGAGGAGTCCCCTGTGG + Intergenic
1178259178 21:31083091-31083113 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1178259686 21:31087689-31087711 AATGAAGCAGCAGACCCCCGCGG + Intergenic
1178585497 21:33867711-33867733 AATGAAGCCGCAGACCCTCGCGG + Intronic
1179030959 21:37719087-37719109 GATGAAGGAGGAGCCCCGAGGGG + Intronic
1180075729 21:45460526-45460548 GATGAAGGAGCAGCCCCTCGGGG - Intronic
1180305253 22:11068026-11068048 GATGAAGGAGGAGTCCCCAGTGG + Intergenic
1182046718 22:27280242-27280264 GATGAAAGAACAGCCCCTCCTGG + Intergenic
1182222422 22:28769466-28769488 AATGAAGCAGCAGATCCTCGCGG - Intergenic
1182546751 22:31081161-31081183 GAGGAAGGCCCCGCCCCTCGCGG - Intronic
1183189502 22:36312637-36312659 TATGTAGGAGGAGCCCCTTGAGG + Intronic
1183361972 22:37387537-37387559 GATGCAGGAGCTGACCCTCCTGG + Intronic
1183583785 22:38740496-38740518 GATGAAAGAGGACCCCCTAGTGG + Intronic
1183732732 22:39627798-39627820 GATGAAGTGGGAGCCCCTTGTGG - Intronic
1183899567 22:40994891-40994913 GAAGAAGGAGCAGCCTCCCCGGG + Intergenic
1184599247 22:45532858-45532880 CCTGAAGCAGCAGCCCCTGGGGG + Intronic
949644152 3:6073924-6073946 GATGATGGAGCAGCTCCTGTGGG + Intergenic
950362421 3:12459053-12459075 GAGGAAGGAACAGCCCTGCGGGG + Intergenic
950622396 3:14216333-14216355 GATGGCGCAGCAGCCCCTAGTGG + Intergenic
950838261 3:15941338-15941360 AATGAAGCTGCAGACCCTCGTGG + Intergenic
952393924 3:32904311-32904333 AATGAAGCCGCAGACCCTCGCGG - Intergenic
953673904 3:44985364-44985386 AATGAAGCTGCAGACCCTCGCGG + Intronic
955353441 3:58210826-58210848 GTTGAAGGAGCAGATCCTCATGG + Exonic
956481665 3:69678865-69678887 AATGAAGCCGCAGACCCTCGCGG - Intergenic
957559983 3:81811184-81811206 AATGAAGCTGCAGACCCTCGCGG + Intergenic
959141461 3:102491606-102491628 AATGAAGCCGCAGACCCTCGTGG + Intergenic
961407630 3:126692950-126692972 GCTGAAGGAGCAGGTCCTAGTGG - Intergenic
961680606 3:128597600-128597622 GATGAAGAAGCAGGGCCTCCGGG + Intergenic
962600323 3:136986763-136986785 AATGAAGCCGCAGACCCTCGCGG + Intronic
963020958 3:140872808-140872830 AATGAAGCAGCGGACCCTCGTGG - Intergenic
963403035 3:144826071-144826093 AATGAAGCTGCAGACCCTCGTGG + Intergenic
963403060 3:144826307-144826329 AATGAAGCTGCAGACCCTCGAGG + Intergenic
964974309 3:162600506-162600528 AATGAAGCCGCAGACCCTCGCGG - Intergenic
965043970 3:163551551-163551573 AATGAAGCCGCAGACCCTCGCGG + Intergenic
966290361 3:178349116-178349138 AATGAAGCCGCAGACCCTCGTGG + Intergenic
967240649 3:187436117-187436139 GAAGAACGAGCAGCCACTTGTGG - Intergenic
968716337 4:2162451-2162473 AATGAAGCCGCAGACCCTCGCGG - Intronic
969610564 4:8225636-8225658 CAGGAAGGAGCAGACCCTTGAGG - Intronic
970340511 4:15101542-15101564 GTAGAAGGACCAGCCCATCGAGG + Intergenic
970700411 4:18730311-18730333 AATGAAGCTGCAGACCCTCGTGG + Intergenic
972791213 4:42373183-42373205 AATGAAGCCGCAGACCCTCGCGG + Intergenic
973039776 4:45456249-45456271 AATGAAGCCGCAGACCCTCGCGG + Intergenic
973135425 4:46700213-46700235 GATGAAGCTGCAGACCCTCGCGG - Intergenic
974451431 4:62066904-62066926 GATAAAGGCTCAGCCCCTCTGGG + Intronic
974792551 4:66711263-66711285 AATGAAGCCGCAGACCCTCGGGG + Intergenic
975745110 4:77467550-77467572 AATGAAGCTGCAGACCCTCGTGG - Intergenic
975898596 4:79123024-79123046 AATGAAGCCGCAGACCCTCGCGG - Intergenic
976862242 4:89679515-89679537 AATGAAGCCGCAGACCCTCGTGG + Intergenic
976933992 4:90605235-90605257 AATGAAGCTGCAGACCCTCGTGG - Intronic
977834285 4:101630892-101630914 AATGAAGCTGCAGACCCTCGCGG + Intronic
978748736 4:112223627-112223649 GATGAAGCCGCAGACCCTCGTGG - Intergenic
979189062 4:117834556-117834578 GATGGAGGAACAGCCCCTTCTGG - Intergenic
979823589 4:125204670-125204692 AATGAAGTTGCAGACCCTCGTGG - Intergenic
982921453 4:161278418-161278440 AATGAAGCTGCAGACCCTCGCGG - Intergenic
983922382 4:173359808-173359830 AATGAAGCTGCAGACCCTCGTGG - Intergenic
984901902 4:184592885-184592907 AATGAAGCCGCAGACCCTCGCGG - Intergenic
985591077 5:765842-765864 AATGAAGCCGCAGACCCTCGCGG - Intronic
985624746 5:979517-979539 GAGGTAGGAGCAGCCCTTCCGGG + Exonic
985702105 5:1379720-1379742 AATGAAGCCGCAGACCCTCGCGG + Intergenic
986172365 5:5325128-5325150 GAAGAGGGAGCAGCACATCGAGG + Intergenic
986313733 5:6572612-6572634 GATGAAGGCGCAGCCTCTGCAGG + Intergenic
990007674 5:50963108-50963130 GGTGCAGGAGCGCCCCCTCGTGG - Intergenic
991094215 5:62722037-62722059 GGAGAAGGAGCAGCCTCTCAGGG + Intergenic
991717702 5:69467136-69467158 AATGAAGCTGCAGACCCTCGTGG - Intergenic
992501714 5:77350024-77350046 GATGAAGGGGAAGCCACTGGAGG - Intronic
993328382 5:86568618-86568640 AATGAAGCCGCAGACCCTCGCGG + Intergenic
994327774 5:98469001-98469023 AATGAAGCCGCAGACCCTCGAGG + Intergenic
994449245 5:99920169-99920191 AATGAAGCTGCAGACCCTCGCGG - Intergenic
994701523 5:103141207-103141229 AATGAAGCCGCAGACCCTCGCGG + Intronic
994935444 5:106247328-106247350 AATGAAGCCGCAGACCCTCGCGG - Intergenic
995582799 5:113618635-113618657 AATGAAGCTGCAGACCCTCGTGG - Intergenic
995920626 5:117306281-117306303 AATGAAGCCGCAGACCCTCGCGG - Intergenic
997329423 5:133048442-133048464 AATGAAGCTGCAGACCCTCGCGG - Intergenic
998132734 5:139659524-139659546 GATGAGGGCCCAGCCCCTCTTGG - Intronic
998372972 5:141672866-141672888 TCTGAAGGAGCAGCGCCTCCTGG - Exonic
998712854 5:144846986-144847008 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1002724149 5:181283383-181283405 GATGAAGGAGGAGTCCCCTGTGG + Intergenic
1002757839 6:178628-178650 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1003124944 6:3348691-3348713 GTTGAATGAGCAGCCGCTAGGGG - Intronic
1003213888 6:4091182-4091204 AATGCAGCAGCAGACCCTCGCGG - Intronic
1003737059 6:8888205-8888227 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1004235353 6:13870840-13870862 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1004850231 6:19691679-19691701 GATGGCGGAGCAGCCCCGAGCGG - Intergenic
1004861217 6:19806189-19806211 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1005023049 6:21435815-21435837 GATGAAGGATCAGCCCTCAGAGG + Intergenic
1006005934 6:31001547-31001569 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1006415015 6:33898414-33898436 AAAGGAGGAGCAGCCCCTTGAGG - Intergenic
1010030874 6:71269418-71269440 GATGAAGGAGAAGGTCCTGGTGG + Intergenic
1010106199 6:72171082-72171104 GGTTAAGGAGCAGCCCTTGGAGG - Intronic
1010617578 6:78031113-78031135 AATGAAGCCGCAGACCCTCGTGG - Intergenic
1011622664 6:89257468-89257490 GAACATGGAGCAGCCCCACGGGG + Intronic
1012441866 6:99268242-99268264 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1013143383 6:107363300-107363322 AATGAAGCCGCAGACCCTCGCGG + Intronic
1013960257 6:115890244-115890266 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1014056065 6:117015934-117015956 AATGAAGCCGCAGACCCTCGTGG - Intergenic
1014586480 6:123203338-123203360 AATGAAGCTGCAGACCCTCGTGG - Intergenic
1015600540 6:134906033-134906055 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1016067194 6:139697101-139697123 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1016092644 6:139998759-139998781 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1017383335 6:153855999-153856021 AATGAAGCGGCAGACCCTCGCGG + Intergenic
1017727532 6:157285882-157285904 GATGAGGGAGCTGCAGCTCGGGG + Intergenic
1019593613 7:1848083-1848105 GATGATGGAGGAGCTCCTGGGGG + Exonic
1021324327 7:19246903-19246925 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1021756095 7:23854633-23854655 AATGAAGCTGCAGACCCTCGTGG + Intergenic
1021778578 7:24078954-24078976 AATGAAGCTGCAGACCCTCGAGG + Intergenic
1022458487 7:30580569-30580591 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1022803357 7:33797137-33797159 AATGAAGCAGCAGACCCTTGCGG + Intergenic
1022822817 7:33977971-33977993 GATGAAGAAGCAGCCAGTTGAGG + Intronic
1023378160 7:39578748-39578770 AATGAAGCTGCAGACCCTCGCGG - Intronic
1024794528 7:53005304-53005326 AATGAAGCTGCAGACCCTCGCGG - Intergenic
1024834223 7:53496196-53496218 AATGAAGCTGCAGACCCTCGCGG - Intergenic
1026383407 7:69821619-69821641 AATGAAGCTGCAGACCCTCGCGG - Intronic
1028303141 7:89228047-89228069 AATGAAGCTGCAGACCCTCGCGG + Intronic
1028913155 7:96229861-96229883 GATGAAGCTGCGGACCCTCGTGG - Intronic
1030078006 7:105753161-105753183 GCTGAAGGAGAAGCCACTGGAGG + Intronic
1030215552 7:107041545-107041567 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1030231270 7:107210435-107210457 GATGAAGGAGCAGTGCCTGGGGG - Intronic
1030420159 7:109299365-109299387 AATGAAGGCGCAGACCCTCGCGG - Intergenic
1032236912 7:130132584-130132606 GAAAAAGGAGCAGCTCCTCTAGG + Exonic
1033585700 7:142773011-142773033 GATTGAGGAGCAGCCTCTGGTGG + Intergenic
1034167586 7:149037916-149037938 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1034870432 7:154678595-154678617 AATGAAGCCGCAGACCCTCGCGG - Intronic
1037811141 8:22087620-22087642 GGTGAAGCTGCAGACCCTCGCGG - Intergenic
1037971164 8:23172975-23172997 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1040954164 8:52962494-52962516 AATGAAGCCGCAGACCCTCGTGG - Intergenic
1041171133 8:55142884-55142906 GACGAAGGAGCAGCGCCTGAAGG + Intronic
1041435910 8:57841496-57841518 GATGAAGCTGCAGACCCTCACGG - Intergenic
1043110316 8:76171194-76171216 AATGAAGCTGCAGACCCTCGCGG - Intergenic
1043164737 8:76889579-76889601 GAAGAAGGAGCAGACCTTCAGGG + Intergenic
1043689978 8:83139566-83139588 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1044591545 8:93917583-93917605 GATGGAGGGGCTGGCCCTCGGGG + Intronic
1045266033 8:100619371-100619393 GCTGAAGGAGCAGCTCCTGCTGG + Intronic
1046490762 8:114950788-114950810 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1047221467 8:122922028-122922050 GATGAAGAAGGAATCCCTCGAGG + Intronic
1047534293 8:125705079-125705101 GCTGAAGGAGCAGCCCCATCTGG + Intergenic
1048186738 8:132248944-132248966 AATGAAGCCGCAGACCCTCGCGG + Intronic
1048437116 8:134428633-134428655 GGTGAAGCAGCAGCACCCCGTGG + Intergenic
1048757319 8:137754302-137754324 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1048937039 8:139366023-139366045 GATCAAGGAGCAGCACCGTGAGG + Intergenic
1049606591 8:143532506-143532528 AATGAAGGAGCAGTCCCACCTGG + Intronic
1050920808 9:11198210-11198232 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1050923934 9:11240187-11240209 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1053886289 9:42646817-42646839 GATGAAGGAGGAGTCCCCTGTGG + Intergenic
1054225309 9:62454266-62454288 GATGAAGGAGGAGTCCCCTGTGG + Intergenic
1055653528 9:78431517-78431539 AATGAAGCCGCAGACCCTCGTGG - Intergenic
1057511303 9:95681465-95681487 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1057518037 9:95738110-95738132 GATGAAGAGGCAGCCCCGGGGGG - Intergenic
1058364746 9:104195648-104195670 AATGAAGCCGCAGACCCTCGCGG - Intergenic
1058526722 9:105866430-105866452 GATGAAGCAGCAGCCCAGAGGGG - Intergenic
1060170566 9:121457785-121457807 GAAGAGGGAGCTGCCCCTCTCGG + Intergenic
1061484006 9:130911293-130911315 AATGAAGCTGCAGACCCTCGTGG - Intronic
1062437292 9:136551933-136551955 GATGGAGAAGCAGCCGCCCGAGG + Intergenic
1185705336 X:2262632-2262654 GAAGGAGAAGCAGCCCCTCCCGG + Intronic
1187555592 X:20348294-20348316 GATGAAGGAACAAGGCCTCGCGG - Intergenic
1188189774 X:27158904-27158926 AATGAAGCGGCAGACCCTCGCGG - Intergenic
1190045583 X:47109398-47109420 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1190690173 X:52907399-52907421 GCTGGCGGAGCAGCCCCTCTGGG - Exonic
1190695810 X:52948393-52948415 GCTGGCGGAGCAGCCCCTCTGGG + Exonic
1192251579 X:69417990-69418012 AATGAAGCTGCAGACCCTCGCGG - Intergenic
1194197526 X:90914081-90914103 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1194340274 X:92698637-92698659 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1196489715 X:116251432-116251454 AATGAAGTCGCAGACCCTCGTGG - Intergenic
1196793777 X:119486692-119486714 AATGAAGCCGCAGACCCTCGCGG + Intergenic
1196846339 X:119899451-119899473 GAGGAAGGTGCAGCTCCCCGGGG + Intronic
1196852953 X:119956092-119956114 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1199094644 X:143725127-143725149 AATGAAGCTGCAGACCCTCGCGG + Intergenic
1199133996 X:144230430-144230452 GATGAAGCCGCGGACCCTCGCGG + Intergenic
1199938662 X:152602394-152602416 GATGAAAGAGCACCCCCTGCTGG - Intergenic
1200648643 Y:5815389-5815411 AATGAAGCCGCAGACCCTCGTGG + Intergenic
1201766637 Y:17579252-17579274 GGTGAAAGAGCAGCCTCTAGTGG + Intergenic
1201834915 Y:18326732-18326754 GGTGAAAGAGCAGCCTCTAGTGG - Intergenic
1201941530 Y:19465867-19465889 GATGAAGGAGCAGTGACTTGGGG + Intergenic
1202090583 Y:21184248-21184270 AATGAAGCTGCAGACCCTCGTGG - Intergenic
1202202240 Y:22365959-22365981 AATGAAGTCGCAGACCCTCGTGG + Intronic