ID: 1180076042

View in Genome Browser
Species Human (GRCh38)
Location 21:45463372-45463394
Sequence GCTGCTATTGTGCCAAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180076038_1180076042 13 Left 1180076038 21:45463336-45463358 CCTGCTATGGGAATGGGGGTGGA 0: 1
1: 0
2: 1
3: 17
4: 187
Right 1180076042 21:45463372-45463394 GCTGCTATTGTGCCAAGAGCTGG 0: 1
1: 0
2: 1
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180076042 Original CRISPR GCTGCTATTGTGCCAAGAGC TGG Intronic
902244414 1:15110896-15110918 ACTGCTAGTGTTCCAAGAGCTGG + Intronic
902397743 1:16141697-16141719 GCTGCTTCTATGCCAAGAGGAGG + Intronic
904006885 1:27367558-27367580 GCTGCTGTAGTGCAAAGGGCTGG - Intergenic
904347361 1:29881898-29881920 GCTGACACTGTGCCAAGCGCTGG + Intergenic
907740987 1:57165518-57165540 ACTGCCATTGTGCAAGGAGCTGG + Intronic
911099976 1:94087811-94087833 TCTGCTATTGTGCCAGGTGCTGG + Intronic
912698109 1:111856336-111856358 GCTGCTATAGGGAGAAGAGCAGG - Intronic
913006710 1:114640027-114640049 GCTGCTTTTGTAGCAAAAGCTGG + Intronic
914387671 1:147187322-147187344 TCTGATATTGAGCCAATAGCAGG - Intronic
916571538 1:166032477-166032499 GCTCTTATTGTTTCAAGAGCTGG + Intergenic
918345791 1:183606077-183606099 GATGCTATTCTGCCTAGGGCAGG + Intergenic
923216177 1:231850130-231850152 TCTGGTAGTGTGCCAAGAGCAGG + Intronic
1063648416 10:7908963-7908985 GCTGCTATGCTGCTAAGGGCTGG + Intronic
1067690530 10:48498593-48498615 GGTGCTATTGTGTGCAGAGCGGG - Intronic
1071849551 10:89554760-89554782 CCTGCTGTTGAGCAAAGAGCAGG - Intronic
1073689812 10:105795910-105795932 GATGCTATTGTGATAAGAGTGGG + Intergenic
1075199990 10:120394665-120394687 GTTGTTATTATGCCAAGAGTAGG + Intergenic
1075216809 10:120543387-120543409 GCTCCTATGGTGGGAAGAGCTGG + Intronic
1079414145 11:20217267-20217289 GCTGCTATTGTCTTAAGGGCAGG - Intergenic
1085677112 11:78533112-78533134 CCTGCTGTTTTGCCAACAGCTGG + Intronic
1086047986 11:82555457-82555479 GCTGCTTTTGTTCTAAGAGGTGG + Intergenic
1088154548 11:106787482-106787504 GCTGCTTTTATGCTAAGGGCTGG - Intronic
1089405921 11:118197325-118197347 GCTGTTTTTGTCCCAAGAGTAGG - Intronic
1089951714 11:122534395-122534417 GTTGCTAGTGGCCCAAGAGCAGG - Intergenic
1100011206 12:89955572-89955594 GCTGCCTGTGTGCCAAGAACTGG - Intergenic
1104049835 12:125187431-125187453 GCTGCTCTTTGGCCAAGAGGAGG - Intronic
1109073783 13:57806478-57806500 CCTGCTGTTGTGCCAGGAACAGG - Intergenic
1114393662 14:22337434-22337456 GCAGATATTGTGCTAAGTGCTGG - Intergenic
1120008295 14:79384872-79384894 GCAGCGATTGTTCCAATAGCTGG - Intronic
1121269022 14:92625533-92625555 TCTACTATTATGCCATGAGCAGG + Intronic
1121452257 14:94016479-94016501 GCTGCTCCTGAGCCAAGAGCAGG - Intergenic
1126857814 15:52855929-52855951 GCTGCTAATGGGCCAAGGGCTGG + Intergenic
1129349976 15:74950258-74950280 GCTTCTCATGTGCCAGGAGCTGG + Intergenic
1134326024 16:13208636-13208658 GCTAATATTTTACCAAGAGCTGG - Intronic
1134423649 16:14117567-14117589 CCAGTTATTGTGCCAGGAGCTGG - Intronic
1135827099 16:25738499-25738521 GCTGCTCTAGTGCCAAGAGAAGG + Intronic
1136673551 16:31878706-31878728 GGTGCTATTGAGCCATGAGCAGG - Intronic
1138203584 16:55107872-55107894 GCTGCAATTGTGTCAAGGGAGGG - Intergenic
1138203778 16:55109267-55109289 GTTGCAATTGTGACAAGAGAAGG + Intergenic
1139177669 16:64709203-64709225 GCTGCTAGAATGCCAATAGCTGG + Intergenic
1139510881 16:67428007-67428029 TCTGCCATTCTGCCAAGAGGAGG + Intergenic
1140126216 16:72121060-72121082 TCTTCTATTGTGCCAAGTCCAGG - Intronic
1140431410 16:74907165-74907187 ACTGCTGTTTTGCCAAGAGGTGG - Intronic
1141917768 16:87111816-87111838 GCTGCTATGGGGCCAACAGACGG + Intronic
1145208053 17:20995072-20995094 GCTCCTATTGTACCAGGAGCAGG + Intergenic
1145248841 17:21286436-21286458 GCTGCTATGGTGGCTGGAGCCGG + Intronic
1150444661 17:65219344-65219366 GCTGCTATTGTTCCAGCAGGTGG + Intronic
1152801475 17:82332803-82332825 GCTGCTGCTGAGCCCAGAGCGGG - Intronic
1152974005 18:195767-195789 TCTGCTACTCTGCCAAGATCAGG - Intronic
1154210484 18:12375606-12375628 GCTGGCAGTGAGCCAAGAGCGGG - Intronic
1155209163 18:23586286-23586308 GCTGCTACTGTGTCCAGCGCAGG - Exonic
1155289386 18:24325367-24325389 ACTGCCAGTGTGCCCAGAGCAGG - Intronic
1156266942 18:35497779-35497801 GCTGCCATTGTGGGAAGGGCTGG + Exonic
1156702930 18:39846044-39846066 GCTGCTCTGGTGCCAGAAGCTGG + Intergenic
1156954287 18:42942920-42942942 GGTGCTAGTGTGTCCAGAGCTGG + Intronic
1165700484 19:37933471-37933493 GCTTCTATGGAGCCTAGAGCTGG - Intronic
925765169 2:7226414-7226436 GCTGCTATTGCTCCTACAGCAGG + Intergenic
927034105 2:19155005-19155027 GCAGGTATTGTGGCAAAAGCAGG + Intergenic
927520715 2:23696423-23696445 GAGGCTATTGTGCCGACAGCGGG - Exonic
929684576 2:44022828-44022850 GCTGCTAATGGGCCATGAACTGG + Intergenic
931763339 2:65434982-65435004 GCTGCTATTAAGCAGAGAGCTGG - Intergenic
931893360 2:66700483-66700505 GCTGCTATTGTTTCAAGGGCTGG + Intergenic
935346569 2:102113654-102113676 GCTGCTAATCAGCCTAGAGCGGG - Intronic
937253352 2:120538110-120538132 GCTGCCACTGTGCCCAGAGGAGG + Intergenic
940057493 2:149528218-149528240 ACTGCTTATGTGCCAAGTGCGGG - Intergenic
941872299 2:170398696-170398718 GATGCTTTTGTGCCAGGAACTGG + Intronic
1168878323 20:1185754-1185776 GCCCCTATTGCGCCAAGCGCAGG + Intronic
1170028098 20:11912640-11912662 GCAGCAATTGTGCCCAAAGCAGG - Intronic
1175660481 20:60808296-60808318 GCAGCCATTGTGCCAGCAGCTGG - Intergenic
1175912606 20:62412004-62412026 GCTGCCATTGAGCCCAGAGCAGG + Intronic
1175913197 20:62414261-62414283 GCTGCTGCTGGGCCAGGAGCAGG + Exonic
1175966717 20:62663560-62663582 GAGGCTATTGTGCCATGACCTGG + Intronic
1176012176 20:62903886-62903908 GCTGCTCTTCTGCCCATAGCGGG - Intronic
1179344909 21:40547169-40547191 GCTGCTATTGTGTCTACACCGGG - Intronic
1180076042 21:45463372-45463394 GCTGCTATTGTGCCAAGAGCTGG + Intronic
1181433974 22:22899681-22899703 GCAGAAATTGTCCCAAGAGCGGG - Intergenic
1181434911 22:22905051-22905073 GCAGAAATTGTCCCAAGAGCGGG - Intergenic
1182742044 22:32574966-32574988 CCTGCTAGTGTGCAAGGAGCAGG - Intronic
1184601249 22:45544697-45544719 GCTGCCATTGGCCCAAGACCAGG - Intronic
950135682 3:10579301-10579323 GCTGCAAATGTGCCCAGAACAGG + Intronic
954915122 3:54142284-54142306 GCTGCTATAGTGGCAAGGGAGGG - Intronic
958854162 3:99364403-99364425 GCAGGTATTGTGCCAAGTGTTGG - Intergenic
961372743 3:126441319-126441341 GCTGCTAGTGCGCCACAAGCAGG + Intronic
961432720 3:126894460-126894482 GATGCTATTGTGCAAGGAACAGG + Intronic
962098617 3:132317902-132317924 GCTGTTTATGTACCAAGAGCTGG + Intronic
965452010 3:168849779-168849801 GCTTCTGTTGTGCCAAGGGATGG - Intergenic
966146330 3:176816446-176816468 GGAGCTATTGTCTCAAGAGCTGG - Intergenic
968427852 4:535081-535103 GCTGCTATGGTGAACAGAGCGGG - Intronic
968574349 4:1358079-1358101 GCTGCCTGTGTGCCAAGGGCTGG - Intronic
969060745 4:4432391-4432413 GCTGCCCGTGTGCCATGAGCAGG - Intronic
972358376 4:38303653-38303675 GCTGCAACTGTGCCAGGGGCAGG + Intergenic
976969971 4:91092547-91092569 GCTGCTGTTTTAGCAAGAGCTGG + Intronic
977847706 4:101785647-101785669 GCTACTATTGTGCTTAGGGCAGG - Intronic
980436475 4:132782123-132782145 GCTGATAGTGTGCCTAGAACAGG + Intergenic
981297375 4:143147341-143147363 GCTGCTTTGGTGCCAGCAGCAGG - Intergenic
984703423 4:182832914-182832936 GCTGCTGTTGTGCCCAGGACAGG + Intergenic
986348623 5:6856904-6856926 GCTGCTGTCCTGCCAACAGCTGG - Intergenic
986720564 5:10558201-10558223 GCTGACAGTTTGCCAAGAGCAGG - Intergenic
987103678 5:14616223-14616245 GCTGAGATTTTGCCTAGAGCAGG + Intergenic
991254090 5:64595654-64595676 GCTACTAATGTCCCCAGAGCTGG + Intronic
996704096 5:126479233-126479255 CTTGCTATGTTGCCAAGAGCTGG + Intronic
998544768 5:143017470-143017492 GCTGATAATGTGCCATGAACAGG - Intronic
999945138 5:156587572-156587594 GCTGCCATTCTGCCATGTGCAGG + Intronic
1000116014 5:158154077-158154099 GCTGCTTCTCTGCCAAGATCTGG + Intergenic
1005901154 6:30217485-30217507 CCTGCTTTTGTGCTAAGAACTGG + Intergenic
1006075083 6:31527365-31527387 GGTGCTATTTTCCCAACAGCAGG - Intergenic
1007762383 6:44140605-44140627 ACTGCTATTTTCCCAAGTGCTGG - Intronic
1014150920 6:118054486-118054508 TTTGTAATTGTGCCAAGAGCAGG - Intronic
1015497713 6:133898070-133898092 GAAGCTCTTGTGCCAAGAACCGG + Intergenic
1017324145 6:153127948-153127970 CCTGCTATTGTGCCAGCACCTGG - Intronic
1019169447 6:170123970-170123992 GCTGCTGTGGTGCCAGCAGCAGG - Intergenic
1021210162 7:17840956-17840978 GCTGCAGTTGTGCTAAGAGCTGG - Intronic
1022354859 7:29604317-29604339 CCTGCTACTCTGCCTAGAGCTGG + Intergenic
1023191274 7:37585606-37585628 GCTGGTGTTGTGACAGGAGCAGG + Intergenic
1024393071 7:48837146-48837168 GGTGCTCTGGTGCCAAGTGCTGG - Intergenic
1028177411 7:87674333-87674355 GCTGCTATCATGGCAGGAGCAGG + Intronic
1031484695 7:122312276-122312298 TCAGCTATTGTGCCAACACCGGG - Intergenic
1032531388 7:132623553-132623575 GCTGCTATGGTGGAAGGAGCTGG - Intronic
1034694663 7:153043036-153043058 GCTGCCTTTGTGCCCACAGCTGG + Intergenic
1038250184 8:25896468-25896490 CCTGTTATTTTGCCAAGAGTGGG + Intronic
1042646502 8:70992863-70992885 ACTGCTAGTGTCTCAAGAGCTGG - Intergenic
1042814736 8:72865983-72866005 GCAGGTCTTGTGCCAGGAGCTGG - Intronic
1043415746 8:80047085-80047107 GCAGCTATTGTTCAAAGTGCTGG + Intronic
1043462798 8:80477849-80477871 ACTGCAATTGTGACAAGGGCTGG + Intergenic
1046097178 8:109575663-109575685 TCTGCCATTGTGTCAAGAGGGGG + Exonic
1048293313 8:133196790-133196812 GATTCTATTGTTCCAATAGCAGG + Intronic
1052299382 9:26936566-26936588 ACTGCTACTGTGCCAAGAGCAGG - Intronic
1062575436 9:137205099-137205121 GATGCTGTTGTGCCAGAAGCTGG - Exonic
1186458855 X:9732406-9732428 GCTGCAATTGTGGGAAAAGCAGG + Intronic
1188643491 X:32535607-32535629 GCTGCTAATATCCCTAGAGCTGG - Intronic
1189952339 X:46245576-46245598 GCAGCTATTGTGGAAAGGGCAGG - Intergenic
1192723960 X:73728394-73728416 GCTGCTATTTTGTCAAGAAAGGG + Intergenic
1198469410 X:136932308-136932330 GCTGCCAGTGTGACTAGAGCAGG + Intergenic