ID: 1180078428

View in Genome Browser
Species Human (GRCh38)
Location 21:45475096-45475118
Sequence GCCCAGCCGGGCGTGCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180078422_1180078428 -4 Left 1180078422 21:45475077-45475099 CCGCCTTGGCGCGTGTTCGGCCC No data
Right 1180078428 21:45475096-45475118 GCCCAGCCGGGCGTGCGCTGGGG No data
1180078417_1180078428 26 Left 1180078417 21:45475047-45475069 CCGGGTTTTCCTGAAGTTTAAAA No data
Right 1180078428 21:45475096-45475118 GCCCAGCCGGGCGTGCGCTGGGG No data
1180078416_1180078428 29 Left 1180078416 21:45475044-45475066 CCTCCGGGTTTTCCTGAAGTTTA No data
Right 1180078428 21:45475096-45475118 GCCCAGCCGGGCGTGCGCTGGGG No data
1180078420_1180078428 0 Left 1180078420 21:45475073-45475095 CCAGCCGCCTTGGCGCGTGTTCG No data
Right 1180078428 21:45475096-45475118 GCCCAGCCGGGCGTGCGCTGGGG No data
1180078418_1180078428 17 Left 1180078418 21:45475056-45475078 CCTGAAGTTTAAAACATCCAGCC No data
Right 1180078428 21:45475096-45475118 GCCCAGCCGGGCGTGCGCTGGGG No data
1180078423_1180078428 -7 Left 1180078423 21:45475080-45475102 CCTTGGCGCGTGTTCGGCCCAGC No data
Right 1180078428 21:45475096-45475118 GCCCAGCCGGGCGTGCGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180078428 Original CRISPR GCCCAGCCGGGCGTGCGCTG GGG Intronic