ID: 1180079102

View in Genome Browser
Species Human (GRCh38)
Location 21:45478162-45478184
Sequence GAGCCTCCTCACACCCACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 164}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180079102_1180079112 4 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079112 21:45478189-45478211 CGCGGGTGCGAGGACATCGGGGG 0: 1
1: 0
2: 0
3: 1
4: 37
1180079102_1180079116 27 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079116 21:45478212-45478234 AAGGCGTCTGCCGCCTCGTGGGG 0: 1
1: 0
2: 0
3: 3
4: 91
1180079102_1180079111 3 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079111 21:45478188-45478210 GCGCGGGTGCGAGGACATCGGGG 0: 1
1: 0
2: 0
3: 4
4: 55
1180079102_1180079114 25 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079114 21:45478210-45478232 GGAAGGCGTCTGCCGCCTCGTGG 0: 1
1: 0
2: 1
3: 1
4: 76
1180079102_1180079115 26 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079115 21:45478211-45478233 GAAGGCGTCTGCCGCCTCGTGGG 0: 1
1: 0
2: 0
3: 1
4: 33
1180079102_1180079113 8 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079113 21:45478193-45478215 GGTGCGAGGACATCGGGGGAAGG 0: 1
1: 0
2: 1
3: 8
4: 160
1180079102_1180079110 2 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079110 21:45478187-45478209 GGCGCGGGTGCGAGGACATCGGG 0: 1
1: 0
2: 0
3: 5
4: 66
1180079102_1180079107 -6 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079107 21:45478179-45478201 AGGCTCCTGGCGCGGGTGCGAGG 0: 1
1: 0
2: 0
3: 15
4: 161
1180079102_1180079109 1 Left 1180079102 21:45478162-45478184 CCCTTGTGGGTGTGAGGAGGCTC 0: 1
1: 0
2: 2
3: 10
4: 164
Right 1180079109 21:45478186-45478208 TGGCGCGGGTGCGAGGACATCGG 0: 1
1: 0
2: 0
3: 1
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180079102 Original CRISPR GAGCCTCCTCACACCCACAA GGG (reversed) Intronic
900209921 1:1450405-1450427 GAGCCTCCTCCCGTCCACATGGG + Exonic
900343334 1:2199033-2199055 CAGCCTCCTCACAGCCTCAGTGG + Intronic
902821904 1:18948588-18948610 GAGTGTCCTCCCACCCACACTGG - Intronic
903302177 1:22386863-22386885 CAGCCTCCTCACAACCTGAATGG + Intergenic
906793856 1:48681328-48681350 TGGCCTCTTCACACCTACAAGGG - Intronic
907617428 1:55938855-55938877 GGGCCTGCTCACACACATAAAGG + Intergenic
908401475 1:63775475-63775497 AAGGCTCCTCACCCCCTCAAGGG - Intronic
912864888 1:113248137-113248159 GAGCCTCATCACTCCCTCCAGGG - Intergenic
915024089 1:152811244-152811266 TTGCCTCCTGACACCCACATAGG - Intronic
915108240 1:153547427-153547449 CCGCCTCCTCCCATCCACAAGGG + Exonic
922916657 1:229263546-229263568 AAGCCTCATCTCACTCACAATGG - Intergenic
924044011 1:240009876-240009898 GAGCCTCCTCTCCTGCACAATGG + Intergenic
1062832595 10:615910-615932 GAGCCTCCCTACAGGCACAAAGG - Intronic
1062897458 10:1115109-1115131 GAGCCACCTGCCACCCACAGAGG - Intronic
1062899617 10:1132960-1132982 GAGTATCTTCACACCCAGAAAGG + Intergenic
1066673822 10:37866865-37866887 GAGTCTCCTCACACCCAGGCCGG + Intergenic
1067287169 10:44914972-44914994 GTGCCTCCTCTGTCCCACAAAGG - Intronic
1070336107 10:75456305-75456327 GTGCCTCTTCACACCCAGCAAGG + Intronic
1070517946 10:77225541-77225563 GAGCCTCCTCCTCCCCACACAGG + Intronic
1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG + Intergenic
1074375898 10:112940520-112940542 GACCCTCCTCACTCCCCCAGGGG - Intergenic
1075266828 10:121007621-121007643 TAGCCTCCTTACCCCCACCATGG - Intergenic
1075676556 10:124299949-124299971 CAGCCTCCTGCCACCCACCAAGG + Intergenic
1076303164 10:129443192-129443214 GAGCCCCGTGACACCCACAAGGG + Intergenic
1076503490 10:130955705-130955727 GAGACACCACACACCCACTAGGG - Intergenic
1078067627 11:8088806-8088828 GAGCCTCATCTCACCCGCACTGG - Intronic
1081204177 11:40255665-40255687 CAGCCTCCTCATTCACACAATGG + Intronic
1082789092 11:57335204-57335226 GAGCATCCGCACACCCACTCAGG - Exonic
1082826007 11:57579366-57579388 GAGCCTCCTCCAACCCAGACAGG - Intergenic
1083205892 11:61148950-61148972 GAGATTCCTCCCACCCACCAGGG + Intronic
1083642421 11:64152757-64152779 GAGCTTCCTCCCACACACTAAGG + Intronic
1084203422 11:67577136-67577158 GAGCCTTCCCACACCTACCAGGG - Intergenic
1085419742 11:76345764-76345786 GAGACACCTCACAGCCACACAGG + Intergenic
1087147063 11:94822886-94822908 ATGCCTCCTCACCCCCAGAAAGG - Intronic
1094672221 12:32581329-32581351 GGGCTTCCTCACACACTCAAGGG - Intronic
1106670131 13:31896480-31896502 GAGCCTCCTCAGCCCCTCCACGG - Intergenic
1108301651 13:49083248-49083270 GAGACTCCTCAAACACACAAAGG + Intronic
1109654061 13:65366579-65366601 CTGCCTCATCACAACCACAAAGG - Intergenic
1118683502 14:68267634-68267656 GAGGGTCCTCAAACCCATAAGGG + Intronic
1118985300 14:70749391-70749413 TAGCCTTCCCCCACCCACAATGG + Intronic
1120967440 14:90180225-90180247 GCAACTCCTCACACCCACACTGG - Intronic
1121731850 14:96192886-96192908 GAGAATCCCCACACCCAGAAAGG - Intergenic
1122231643 14:100309041-100309063 CAGCCCCCTGTCACCCACAAGGG - Intergenic
1123196199 14:106618812-106618834 GATGCTCCTCATAACCACAAAGG - Intergenic
1123695359 15:22875174-22875196 GAGCCTGCTGACCCCCACCAGGG - Intronic
1123702501 15:22925970-22925992 GAGCATCCTCACCTCCACTAGGG + Exonic
1129142305 15:73610851-73610873 GAGACTCTTCACTTCCACAATGG + Intronic
1129272031 15:74424080-74424102 GAGCATCCTCCCACCCACCAAGG + Intronic
1129326768 15:74803895-74803917 AAGCCTCCTCACACCTTCAGAGG - Intergenic
1129651772 15:77496115-77496137 GCCCCTCCTCCCACCCAGAAAGG - Intergenic
1129912910 15:79242971-79242993 GAACACCCTCACACCCAGAATGG - Intergenic
1130127587 15:81106779-81106801 GAGCCACCACACAGCCACACTGG - Intronic
1130839984 15:87689340-87689362 GAGTCTCCACCCACCCACATTGG + Intergenic
1132232457 15:100194017-100194039 GACACTCCTCACTCCAACAAAGG + Intronic
1132993076 16:2807426-2807448 GGCCCTGCTGACACCCACAATGG - Intergenic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133232785 16:4374341-4374363 CAGCCTCCTCACACCCAGGGAGG - Intronic
1133622231 16:7537376-7537398 GAGCATCATCACATCCTCAATGG - Intronic
1134100940 16:11450896-11450918 GAGTCTCATCACAGCCGCAATGG + Intronic
1136173818 16:28504172-28504194 CTGCCTCCTCAAAACCACAATGG + Intronic
1137797196 16:51231962-51231984 TAGCACTCTCACACCCACAAAGG + Intergenic
1137807965 16:51325462-51325484 GAGCCTACTCTCACACACATGGG - Intergenic
1137943544 16:52712726-52712748 CAGCCTCCTCACATCCTTAAAGG + Intergenic
1139251486 16:65500662-65500684 GGGCCTCCTAACATCCACAATGG - Intergenic
1142066389 16:88065364-88065386 GAGACTCCTCCCAGCCACAGAGG - Intronic
1144706435 17:17371405-17371427 GAGATTCCTCAGACACACAAAGG - Intergenic
1145020892 17:19429819-19429841 CAGCTTTCTCACACACACAAAGG + Intergenic
1146052198 17:29563007-29563029 GAGCCTCCTCAAACTCTCGAAGG + Exonic
1146420088 17:32676634-32676656 CCGCCACCTCACAACCACAAGGG + Intronic
1148484147 17:47979819-47979841 GAGGCTCCTCCCAGCCTCAAGGG + Intronic
1149412516 17:56423428-56423450 GACCCTCCTTACACCAACACTGG + Intronic
1152241080 17:79161495-79161517 GGGCCTCCACACACCCCCGAGGG - Intronic
1152291582 17:79442908-79442930 GAAGCTCCCCACAGCCACAATGG + Intronic
1160772841 19:840815-840837 CAGCCTCCCCGCCCCCACAAAGG + Intergenic
1161268855 19:3378455-3378477 GGGCCTCCCCACACCCAGACAGG + Intronic
1162439879 19:10686391-10686413 GAGCCTTCCCACACCCACTGTGG + Intronic
1162967735 19:14164012-14164034 GACACTCCTGACACCCACAGTGG - Intronic
1166956011 19:46465234-46465256 GTGCCCCCACACCCCCACAATGG - Intergenic
1168533132 19:57145935-57145957 GAGCCACCGCACACCGCCAAGGG - Intergenic
1168679015 19:58300331-58300353 GAGTCTCCTCATGACCACAATGG - Exonic
1168682582 19:58326868-58326890 GCGCCACCTCAGTCCCACAAAGG + Intergenic
1168720273 19:58550887-58550909 GACCCTCCCCATACCCAGAAAGG - Intergenic
927523618 2:23718321-23718343 TAGCCTCCTCACAGCAACAGTGG + Intergenic
932451678 2:71814514-71814536 GAGCCACCTGGTACCCACAAAGG + Intergenic
934627955 2:95879226-95879248 GAAATTTCTCACACCCACAAAGG - Intronic
934937933 2:98478631-98478653 GACCCTCTTCACAGCCACATTGG - Intronic
937086498 2:119175227-119175249 GAGGCTCCTCATGCCGACAATGG - Intergenic
938101554 2:128501166-128501188 GAGCCTCCTCACCCACTCCAGGG - Intergenic
940316668 2:152334925-152334947 GACCCTCCTCACCCCAACAGTGG - Intergenic
948102703 2:235387929-235387951 ATGCCTCATCACACCCACTAGGG - Intergenic
1168730526 20:75035-75057 AAGTAACCTCACACCCACAAAGG + Intergenic
1171277695 20:23872336-23872358 GAGCCTCCTCACATTCAGGAAGG + Intergenic
1173069580 20:39749927-39749949 AAGCCTGCTAACACTCACAATGG + Intergenic
1173554293 20:43954582-43954604 GAGCCTCCAGCCACCCTCAAAGG - Intronic
1175616877 20:60407238-60407260 GGGCCTGCTCACACCCATGAGGG + Intergenic
1175704089 20:61162963-61162985 GGGTCTCCTCCCACCCACGATGG - Intergenic
1175826254 20:61938083-61938105 GGGCCTCCTGCCACCCACACAGG - Exonic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177370431 21:20196701-20196723 CAGCCTCCTCAGACCCCCACTGG - Intergenic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180260816 21:46667596-46667618 GAGCCTCCGCCCACCCCCAGAGG - Intergenic
1182432758 22:30310052-30310074 GATCCTCCTCTCACCCATAGGGG + Intronic
1184033535 22:41908247-41908269 GAGCCTACACAGACTCACAAAGG - Intergenic
1184279479 22:43428822-43428844 GAGCCTCCTGAGACCCCCATAGG - Intronic
1184852696 22:47129807-47129829 CAGCCTCCTCACACCGCCAGAGG + Intronic
1184900717 22:47444898-47444920 GAGCCTCCTAGCACCCAACAGGG + Intergenic
1185164977 22:49255853-49255875 GCGCCTCCTCAATCCCACAAAGG + Intergenic
949890583 3:8730935-8730957 GAGCCTCCTTACACACACCAAGG + Intronic
950482469 3:13253062-13253084 AAGCAACCTCACACCCACCAGGG - Intergenic
950702883 3:14762188-14762210 CAGCCTCCCCACACAGACAAAGG + Intronic
952076657 3:29705037-29705059 GGGCCTCATCACATGCACAAGGG - Intronic
953413698 3:42703632-42703654 GAGCCTCCCCACAAGCACACAGG - Intronic
954140051 3:48600151-48600173 GAGCCTTCTCTCACCCTTAAAGG - Exonic
954335071 3:49911607-49911629 GTGCCTCCTCAGACCCATAGCGG + Exonic
958606484 3:96364620-96364642 GAGCCTGCACACACCTCCAAAGG + Intergenic
960574626 3:119217904-119217926 GGGCCTCCTGACACCCAGAATGG + Intronic
960596879 3:119414978-119415000 GAGGCTCCTCCCAACCAGAAGGG + Exonic
961210420 3:125120884-125120906 GAGCCTCCTCCAACCCACAAAGG - Intronic
961727074 3:128938364-128938386 GAACTTCCTCAGACCCATAAAGG + Intronic
965668902 3:171126049-171126071 GAGCCTCCTGAAACCCAGAGAGG + Exonic
966660818 3:182412369-182412391 GATGCTCCTCACAACCACACTGG + Intergenic
967729098 3:192890780-192890802 GATCCTCCTCACATCCTCCATGG + Intronic
968771729 4:2511804-2511826 CACCCTCCTCCCACCCACAGAGG - Intronic
970657258 4:18245300-18245322 GAGCTACCTGAAACCCACAAAGG - Intergenic
979459115 4:120960254-120960276 GAGTCTGCAAACACCCACAAAGG + Intergenic
981078858 4:140618317-140618339 CAGCATCCTCACCCCCACCAAGG - Intergenic
982625498 4:157760782-157760804 GAGTCACCTCACCCTCACAAGGG - Intergenic
983003287 4:162447744-162447766 TAAACTCCTCACACCCACAGTGG - Intergenic
986738159 5:10682655-10682677 AGGCCCCCTAACACCCACAAGGG - Intronic
996024313 5:118627852-118627874 AAGCATCGCCACACCCACAATGG - Intergenic
997290665 5:132731487-132731509 GAACTTCCTCAAACCTACAAAGG + Intronic
997887906 5:137647967-137647989 AAGCCTCCTGACACCCATATGGG - Intronic
1002641508 5:180632811-180632833 GGGCCTGCTCCCACCCACACCGG - Intronic
1002981753 6:2144686-2144708 CAGCCTCTTCCCAACCACAATGG + Intronic
1003538254 6:6995099-6995121 GAGCCTCAGCGCATCCACAATGG + Intergenic
1005836083 6:29710641-29710663 GAGCCTCCACCCACCCTCACAGG + Intergenic
1006066128 6:31463797-31463819 GATTCTCCTCACACTTACAATGG + Intergenic
1006359503 6:33579525-33579547 GAGCCTCAGAACACCCACCAAGG + Intronic
1006389212 6:33748772-33748794 GGGCCTCCCCACACCCAGAGAGG + Intergenic
1012647113 6:101699547-101699569 GAGCATCCTCAGTCCCTCAAAGG + Intronic
1018385113 6:163296057-163296079 GAGTCTCCTAACACCCCCCAGGG - Intronic
1018710445 6:166494878-166494900 AAGGCCCCTCACACGCACAACGG + Intronic
1019610804 7:1935824-1935846 GAGCCTGCAGACACCCCCAAGGG + Intronic
1021180239 7:17497577-17497599 GACCCTACTCAGACCTACAAGGG - Intergenic
1022497445 7:30861932-30861954 GTCCCTCCTCACACCCCCAGTGG - Intronic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1028777611 7:94697042-94697064 GAGCCCCATGACACCCACAATGG - Intergenic
1029620869 7:101689004-101689026 GAGCCTTCTCACTCTCACACGGG - Intergenic
1032524608 7:132570480-132570502 GAGCCTCCACACTACCAAAAGGG + Intronic
1037380209 8:18277136-18277158 GAGACTCTTCGCACCCACAGTGG + Intergenic
1037508768 8:19560567-19560589 GACCCACTTCACACACACAAGGG + Intronic
1037950833 8:23017943-23017965 AAGCCTACTCACACCCTCACTGG + Exonic
1038549883 8:28458132-28458154 GTGCCCCCTCACCCCCAAAAGGG + Intronic
1038699871 8:29839979-29840001 TATCCTCCTCACCCGCACAAAGG + Intergenic
1043399207 8:79867287-79867309 CAACCCCCTCACACCCACAGTGG + Intergenic
1046259007 8:111741356-111741378 CAGGCTCCTCCCAGCCACAAAGG - Intergenic
1047762733 8:127966296-127966318 TAGCTTCCTCATCCCCACAATGG - Intergenic
1048857578 8:138697605-138697627 GAGCCTCCTCAGTCCCAGAGAGG + Intronic
1049283274 8:141761360-141761382 GAGCCCCCTCAGCCCCACACTGG + Intergenic
1051629713 9:19129981-19130003 GAGACTCTTCAAGCCCACAAAGG + Intronic
1052164046 9:25300193-25300215 GGGCCTCCTCACACTCAGAAGGG + Intergenic
1053475649 9:38380367-38380389 GAGGCTCATCACACCCACGTGGG - Intergenic
1061473063 9:130842784-130842806 CAGCCTGCTAATACCCACAAAGG - Intronic
1061890837 9:133618284-133618306 GACCCTCCTCCCACCCACGTGGG + Intergenic
1062331563 9:136047176-136047198 GAACGTCCTCACACCCACGCAGG - Intronic
1185772411 X:2774495-2774517 GGGCATCCTCACAGCCTCAAGGG + Intronic
1187253653 X:17622164-17622186 GTGCCTCCCCACACCTACACTGG - Intronic
1190277828 X:48910664-48910686 GATCCTCCTCATACCCAGAATGG + Intronic
1190731935 X:53232361-53232383 GCTCCTCCTCATCCCCACAATGG - Intergenic
1192588114 X:72336700-72336722 GAGCCACCACACCCCCAAAATGG + Intronic
1192810013 X:74538947-74538969 GAGACTCCTCATATCCACAGGGG + Intergenic
1198483126 X:137059168-137059190 GAGCTTCCTCACTGGCACAAAGG + Intergenic
1200275829 X:154731412-154731434 GAGCCTCCCCTCAACCACATTGG - Intronic