ID: 1180081753

View in Genome Browser
Species Human (GRCh38)
Location 21:45490448-45490470
Sequence GGGTCTCCATGTGCCCTCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 142}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180081746_1180081753 -8 Left 1180081746 21:45490433-45490455 CCCTCCCGGGTCCCTGGGTCTCC 0: 1
1: 0
2: 2
3: 71
4: 352
Right 1180081753 21:45490448-45490470 GGGTCTCCATGTGCCCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 142
1180081747_1180081753 -9 Left 1180081747 21:45490434-45490456 CCTCCCGGGTCCCTGGGTCTCCA 0: 1
1: 0
2: 3
3: 76
4: 2568
Right 1180081753 21:45490448-45490470 GGGTCTCCATGTGCCCTCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180081753 Original CRISPR GGGTCTCCATGTGCCCTCGT GGG Intronic
901082026 1:6588921-6588943 GGATCTCCATGTGCCTCCGCAGG - Exonic
902255735 1:15187493-15187515 GGGGCTCCATCTGCCCCCATGGG - Intronic
905226613 1:36482996-36483018 GGGGCTGCCTGTGCCCTCGAAGG - Exonic
924038177 1:239956827-239956849 GGGTCTCTATGGGCCCACATTGG + Intergenic
1067295240 10:44971873-44971895 GGGTCACCATGTACCCTGGGAGG + Intronic
1070228863 10:74542163-74542185 AGGTCACCATGTGACCTCCTGGG - Intronic
1072763755 10:98079820-98079842 CGTTCTCCATGTGCCCTGGAGGG + Intergenic
1076412712 10:130263562-130263584 GGGTCTCAATGTGCCCCTGTCGG + Intergenic
1076948771 10:133667660-133667682 GGGTCACCCTGCTCCCTCGTGGG + Exonic
1076949755 10:133670959-133670981 GGGTCACCCTGCTCCCTCGTGGG + Intronic
1076950739 10:133674258-133674280 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076951729 10:133677568-133677590 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076952718 10:133680878-133680900 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076953702 10:133684177-133684199 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076955675 10:133743839-133743861 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076956665 10:133747149-133747171 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076957652 10:133750458-133750480 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076958637 10:133753757-133753779 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076959626 10:133757067-133757089 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1076960610 10:133760366-133760388 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
1077413617 11:2414588-2414610 GGGGCTCCAGGTGCCCTCAGGGG - Intronic
1081868376 11:46372070-46372092 GGGTCTCCAGCGGCCCTCCTGGG - Exonic
1082676560 11:56112316-56112338 TGGTCTAAATGTGCCCTCCTTGG - Intergenic
1083180834 11:60984034-60984056 GGCTCTCCATGTCCCCTCTCCGG + Intronic
1083692550 11:64419217-64419239 GGCTCTCTCTGTGCCCTCCTCGG + Intergenic
1092217694 12:6694460-6694482 GGGGCTCCTTGGGCCCTCATCGG - Exonic
1096618634 12:52848688-52848710 GGCTCTCCCTGTGCCCTCCGGGG - Exonic
1099113020 12:78586740-78586762 AGGTGTGCATGTGCCCTGGTGGG + Intergenic
1100865567 12:98853391-98853413 CGCTCTCCATGGGCCCTCGGTGG - Intronic
1106285162 13:28312329-28312351 GGGTATCCATGAGCTCTGGTGGG - Intronic
1109082162 13:57918377-57918399 AGGTCTCCATGTGCTCTCAAGGG - Intergenic
1123065753 14:105618389-105618411 GGGCCTCCGGGTGCCCTGGTGGG - Intergenic
1123069915 14:105637635-105637657 GGGCCTCCAGGTGCTCTGGTGGG - Intergenic
1123089151 14:105734422-105734444 GGGCCTCCGGGTGCCCTGGTGGG - Intergenic
1202862215 14_GL000225v1_random:89987-90009 GTGTCTCCCTTTTCCCTCGTGGG - Intergenic
1123893980 15:24809738-24809760 TGGTCTCCATGTGCCCATTTGGG - Intergenic
1124067258 15:26355772-26355794 GGAACTCCATGTGCCCTTCTGGG - Intergenic
1124101032 15:26693426-26693448 GGCACTTCATGTGCCCTTGTTGG + Intronic
1125431021 15:39593555-39593577 GAGTATCCCTGAGCCCTCGTGGG - Exonic
1129382951 15:75179070-75179092 TGGTCTCCATGTCCCCTCAGAGG - Intergenic
1132906379 16:2284761-2284783 TGGTCTCCAGGTGCCCACCTGGG + Exonic
1134044046 16:11088511-11088533 GGGTCGCCATGGGCCTTCCTTGG - Intronic
1138530032 16:57629878-57629900 GGGTCTCCCTGTGCCCCACTGGG + Intronic
1139314269 16:66055147-66055169 GGGCCTCCAAGTGCCACCGTGGG + Intergenic
1141594408 16:85088623-85088645 AGGACTCCATGGGCCATCGTGGG + Exonic
1142243233 16:88956546-88956568 GGGCCTCCATGTCCCCTGCTGGG - Intronic
1143153919 17:4823646-4823668 AGTTCTCCAGGTGCCCTGGTTGG - Intergenic
1143300781 17:5909346-5909368 GGGCCTCCATGTGCCCGTGTGGG - Intronic
1143513679 17:7408754-7408776 GGGTCTGCATGTGCGTTTGTGGG - Intronic
1145720929 17:27072065-27072087 GGGTCTCCCTGTTCTCACGTGGG + Intergenic
1145761699 17:27429317-27429339 GGGTCACCCTCTGCCCTCCTGGG - Intergenic
1146842795 17:36166960-36166982 GGGTCACCCTCTGCCCTCCTGGG + Intronic
1146855108 17:36254919-36254941 GGGTCACCCTCTGCCCTCCTGGG + Intronic
1146865512 17:36333456-36333478 GGGTCACCCTCTGCCCTCCTGGG - Intronic
1146871008 17:36378812-36378834 GGGTCACCCTCTGCCCTCCTGGG + Intronic
1146878366 17:36429894-36429916 GGGTCACCCTCTGCCCTCCTGGG + Intronic
1146882315 17:36451040-36451062 GGGTCACCCTCTGCCCTCCTGGG + Intergenic
1147068381 17:37934068-37934090 GGGTCACCCTCTGCCCTCCTGGG - Intronic
1147073892 17:37979436-37979458 GGGTCACCCTCTGCCCTCCTGGG + Intronic
1147079904 17:38013605-38013627 GGGTCACCCTCTGCCCTCCTGGG - Intronic
1147085413 17:38058974-38058996 GGGTCACCCTCTGCCCTCCTGGG + Intronic
1147095853 17:38137565-38137587 GGGTCACCCTCTGCCCTCCTGGG - Intergenic
1147101360 17:38182940-38182962 GGGTCACCCTCTGCCCTCCTGGG + Intergenic
1149845957 17:60009446-60009468 GGGTCACCCTCTGCCCTCCTGGG + Intergenic
1150084306 17:62266026-62266048 GGGTCACCCTCTGCCCTCCTGGG + Intergenic
1151349615 17:73524113-73524135 GGGCCTCCATTTGCCCTCCCTGG + Intronic
1151962773 17:77415875-77415897 TGCTCTCCAGGTGCCCTCCTGGG - Intronic
1160511975 18:79457889-79457911 GGGTCCTCAGGTCCCCTCGTTGG + Intronic
1163297580 19:16422104-16422126 GTGGCTCCATCTGCCCTGGTGGG - Intronic
1163704520 19:18804477-18804499 AGGCCTCCATGTGGCCTCGCTGG + Intergenic
1166365928 19:42278489-42278511 GGGGCTCCCTGTGCCTTCCTGGG + Intronic
1166924373 19:46256560-46256582 GATTCTCCAGGTGCCCTCCTTGG + Intergenic
925019808 2:559366-559388 GAGTCTCCAGGTGCTCTCCTGGG + Intergenic
926389849 2:12378354-12378376 GGTTCTCCATGTCCCCCCGGAGG - Intergenic
936877849 2:117213879-117213901 GGGCCTTTATGTGCCCTCTTCGG + Intergenic
945174075 2:207023834-207023856 GGGTCTTCATGTGCCCCCTAGGG + Intergenic
948992076 2:241560363-241560385 GGCGCCCCATGTGCCCTCTTCGG - Intronic
1174235262 20:49085086-49085108 GGTTCTCGATGTGCCTTCTTAGG + Intronic
1174576914 20:51543113-51543135 GCGTCTCCGTGTGCCCACGGGGG + Intronic
1180081753 21:45490448-45490470 GGGTCTCCATGTGCCCTCGTGGG + Intronic
1180081762 21:45490476-45490498 GGGCCTCCGTGTGCCCTCCCGGG + Intronic
1180081782 21:45490534-45490556 GGGCCTCCGTGTGCCCTCCTGGG + Intronic
1180081788 21:45490554-45490576 GGGTCTCCGTGTGCCCTCTCAGG + Intronic
1180081797 21:45490582-45490604 GGGCCTCCGTGTGCCCTCCCGGG + Intronic
1184657736 22:45950259-45950281 GGATCTGCTTGTGCCCTGGTGGG - Intronic
1185303216 22:50095006-50095028 GGGTCTCTATGTGCCCAGGCTGG - Intronic
950484770 3:13266687-13266709 GGGTCTCCCTGTGCCTACCTTGG - Intergenic
953479926 3:43242753-43242775 CTGTCCCCATGTGCCCTCTTAGG + Intergenic
954493440 3:50930405-50930427 GGGTCTCCCTGGGCTCTTGTGGG - Intronic
957809053 3:85193871-85193893 GGCTCTCCTTGAGCCCTCCTAGG - Intronic
958573065 3:95912155-95912177 GGGCCTCCATGTGCTCTTGGGGG - Intergenic
968560396 4:1277877-1277899 GGGTCTCCATCTGCCCACCTGGG - Intergenic
968656529 4:1780710-1780732 GGGTTTCCATGGGCCCTAGACGG + Intergenic
969868607 4:10091435-10091457 GGCTCTCCATGGCCCCTCGGGGG - Intronic
973194904 4:47428564-47428586 GTGTCACCATATGCCCTCCTGGG + Intergenic
983187847 4:164721055-164721077 GGGTCTGCATGTGCACTAGGAGG + Intergenic
983457294 4:167981221-167981243 CAGTCTCCATGTGCCCTTATAGG + Intergenic
985446148 4:190022134-190022156 GGGTCACCCTGCTCCCTCGTGGG - Intergenic
985452225 4:190068444-190068466 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
985453209 4:190071741-190071763 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985454199 4:190075034-190075056 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985455187 4:190078327-190078349 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985456175 4:190081627-190081649 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985457159 4:190084921-190084943 GGGTCACCCTGCTCCCTCGTGGG + Intergenic
985458146 4:190088214-190088236 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985459135 4:190091514-190091536 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985463388 4:190174283-190174305 GGGTCACCCTGCTCCCTCGTGGG + Exonic
985634896 5:1031092-1031114 GGGGGTCCAGGTGCCCTCGAGGG + Intronic
985949687 5:3213941-3213963 GGGACTCCGTGTGCCCTGGCAGG - Intergenic
992067814 5:73123560-73123582 GGGCCTGCATGTGCCGTGGTTGG + Exonic
994584012 5:101682624-101682646 GGGTCTCAATGTGCTTTCTTAGG + Intergenic
994997187 5:107078975-107078997 GGTTCTCCATGTGCCATTTTAGG + Intergenic
1001287828 5:170436507-170436529 GGGTTTCCGTGTTCCCTCCTGGG - Intronic
1001630414 5:173170868-173170890 GGGTCTCCCTGGGGCCTCTTTGG - Intergenic
1002072507 5:176688505-176688527 GAGTCTCCCTGTGCTCTTGTGGG - Intergenic
1002087842 5:176786801-176786823 GGGTCCCCATGGGTCCTTGTTGG - Intergenic
1004885185 6:20044429-20044451 GTGTCTACATGTGTCCTTGTAGG - Intergenic
1005790499 6:29295527-29295549 GGGCCTCCATGTGCTCTTGAGGG + Intergenic
1005845195 6:29771640-29771662 GGCCCACCATGTGCCCTAGTGGG + Intergenic
1006509076 6:34512107-34512129 GGGTGTCCCTGTGCCAGCGTGGG + Intronic
1007215647 6:40235285-40235307 GGGTCTCCAGCTGCCCCCATCGG + Intergenic
1007242459 6:40436924-40436946 GGCTGTTCATGTGCTCTCGTGGG - Intronic
1010948378 6:82005583-82005605 TGGTCTGCATGTGCCATTGTTGG + Intergenic
1018288318 6:162264535-162264557 GGGTGTCCTGGTGCCCTCCTGGG - Intronic
1020862767 7:13515665-13515687 GGGTTTCCATGACCCCTCTTGGG + Intergenic
1028105846 7:86877694-86877716 GGGTCTCCAGGTCCCCAGGTGGG - Exonic
1030954568 7:115836198-115836220 AGGTCTCCATGTGCCCAAGAGGG - Intergenic
1036815878 8:11902548-11902570 GTGTCGCCATCTGTCCTCGTGGG - Intergenic
1036893460 8:12611397-12611419 GGGCCTCCATGTGGCTTCTTTGG - Intergenic
1038426980 8:27469936-27469958 GGGTCTCCAGGAGCCCTGGGAGG + Exonic
1043984019 8:86672543-86672565 GGGTCTACATGAGCCCATGTAGG + Intronic
1048982414 8:139709893-139709915 GGGTGTCCTTGTGGCCACGTGGG + Intergenic
1049622493 8:143604961-143604983 GGGTCTGCATGTGTCCTGGCTGG + Exonic
1050260333 9:3834959-3834981 GGGTGGCGATGTGCCCTTGTGGG + Intronic
1053397861 9:37790885-37790907 GGGTCTCAATCTGCCCTGGCTGG - Intronic
1057474389 9:95386236-95386258 GGGTGTCCATGGGACCTGGTTGG - Intergenic
1059092046 9:111369973-111369995 GGGTGTCCATTTGCCCTCCATGG - Intronic
1061417126 9:130453169-130453191 GGGTCCCCATGGGCCCTACTGGG - Intronic
1061497412 9:130982879-130982901 GGGCCTTCACGTGCCCTCCTGGG - Intergenic
1061731804 9:132620797-132620819 AGGTATCCATGTGCCCTCAGGGG - Intronic
1191720105 X:64222313-64222335 GAGTGTCCATGTGCCTTCTTGGG + Intergenic
1197421191 X:126238164-126238186 GGGCCTCCATGTGCTCTTGGGGG + Intergenic
1198217261 X:134567127-134567149 GGGCCTCCATGTCCTCTCATAGG + Intronic
1199188103 X:144939921-144939943 GGGCCTCCATGTGCTCTCGGGGG - Intergenic
1200184672 X:154174641-154174663 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200190325 X:154211779-154211801 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200196076 X:154249581-154249603 GGGTTTCCATGGGCCCTCAGGGG - Intergenic
1200201731 X:154286699-154286721 GGGTTTCCATGGGCCCTCAGGGG - Intronic
1202058177 Y:20857677-20857699 AGGTCTCCATGAGCCGTGGTGGG + Intergenic