ID: 1180082070

View in Genome Browser
Species Human (GRCh38)
Location 21:45491497-45491519
Sequence CTCCAACACCACATGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 9, 3: 17, 4: 173}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180082070_1180082076 -7 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082076 21:45491513-45491535 GTTGGAGACACCGAGGAGAGGGG 0: 1
1: 0
2: 0
3: 18
4: 265
1180082070_1180082082 9 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082082 21:45491529-45491551 AGAGGGGAGGGCCTGCACAGGGG 0: 1
1: 0
2: 4
3: 45
4: 515
1180082070_1180082075 -8 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082075 21:45491512-45491534 TGTTGGAGACACCGAGGAGAGGG 0: 1
1: 0
2: 1
3: 13
4: 208
1180082070_1180082074 -9 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082074 21:45491511-45491533 GTGTTGGAGACACCGAGGAGAGG 0: 1
1: 0
2: 1
3: 12
4: 146
1180082070_1180082077 -4 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082077 21:45491516-45491538 GGAGACACCGAGGAGAGGGGAGG 0: 1
1: 0
2: 6
3: 41
4: 619
1180082070_1180082078 -3 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082078 21:45491517-45491539 GAGACACCGAGGAGAGGGGAGGG 0: 1
1: 0
2: 5
3: 53
4: 682
1180082070_1180082084 30 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082084 21:45491550-45491572 GGCCAGTGTTTTTACGTCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 62
1180082070_1180082081 8 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082081 21:45491528-45491550 GAGAGGGGAGGGCCTGCACAGGG 0: 1
1: 0
2: 7
3: 57
4: 515
1180082070_1180082080 7 Left 1180082070 21:45491497-45491519 CCCAGCTCCATGTGGTGTTGGAG 0: 1
1: 1
2: 9
3: 17
4: 173
Right 1180082080 21:45491527-45491549 GGAGAGGGGAGGGCCTGCACAGG 0: 1
1: 0
2: 8
3: 92
4: 1376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180082070 Original CRISPR CTCCAACACCACATGGAGCT GGG (reversed) Intronic
900148971 1:1170037-1170059 ATCCAACACCGCCCGGAGCTCGG + Intergenic
900997705 1:6131340-6131362 GTCCAACACCACTTGTAACTGGG + Intronic
902147623 1:14416802-14416824 GGCCACCACCACATGCAGCTGGG - Intergenic
902358467 1:15926279-15926301 CACCACCACCACAAGTAGCTGGG - Intronic
902461660 1:16582023-16582045 CTCCAACACCAAACGGAGAGGGG + Intronic
902462441 1:16588328-16588350 CTCCAACACCAAACGGAGAGGGG + Intronic
902764902 1:18607547-18607569 CTCCAACAACACTGTGAGCTGGG + Intergenic
903159120 1:21472291-21472313 CTCTAACACCACATGGCGAGGGG - Intronic
904282704 1:29432590-29432612 CTCCAACACTGCAGGGAGCAGGG - Intergenic
907765736 1:57408838-57408860 CTGCAACACTCCATGGAGCAGGG - Intronic
911062367 1:93759363-93759385 CTGCAGCACCACACTGAGCTGGG + Intronic
911889117 1:103344691-103344713 CTCCAACACTGCCTGGAGATAGG + Intergenic
913543119 1:119840865-119840887 CTCCAACACCATATGGTGAGGGG + Intergenic
913603030 1:120440189-120440211 CTCCAACACCACATGGAGAGGGG - Intergenic
913603778 1:120446541-120446563 CTCCAACACCACATGGAGAGGGG - Intergenic
913640644 1:120809258-120809280 CTCCAACACCACATGGAGAGGGG - Intronic
914211881 1:145587366-145587388 CTCCAACACCACATGGAGAGGGG + Intergenic
914277835 1:146141087-146141109 CTCCAACACCACATGGAGAGGGG + Intronic
914364210 1:146963804-146963826 CTCCAACACCACATGGAGAGGGG - Intronic
914365735 1:146976383-146976405 CTCCAACACCACACGGAGAGGGG - Intronic
914381396 1:147119567-147119589 CTCCAACACCACACGGTGAGGGG + Intergenic
914486709 1:148117059-148117081 CTCCAACACCACACGGAGAGGGG + Intronic
914487472 1:148123332-148123354 CTCCAACACCACACGGAGAGGGG + Intronic
914538880 1:148592035-148592057 CTCCAACACCACATGGAGAGGGG + Intronic
914587816 1:149078486-149078508 CTCCAACACCACATGGAGAGGGG + Intronic
914627799 1:149479589-149479611 CTCCAACACCACATGGAGAGGGG - Intergenic
917135350 1:171783924-171783946 GTCCAACACCACCTGGAACGAGG - Exonic
918380522 1:183950063-183950085 CCCAAACATCACATGGGGCTTGG - Intronic
921281773 1:213574767-213574789 CTCTAACACCAAATCAAGCTGGG - Intergenic
922067321 1:222156944-222156966 CTAAAACCCTACATGGAGCTAGG + Intergenic
922764881 1:228151538-228151560 CTCGAGCTCAACATGGAGCTGGG - Intronic
923269183 1:232339308-232339330 CTTGAACACCACTCGGAGCTGGG - Intergenic
923378428 1:233390171-233390193 TTCTGACACCAGATGGAGCTTGG - Intergenic
1063152427 10:3348926-3348948 TTCCAATACCACATGAAGCTGGG - Intergenic
1063185426 10:3646342-3646364 TTCCAACACCACATGGGAGTAGG + Intergenic
1064310156 10:14205264-14205286 CTCCATAGCCACATGTAGCTGGG + Intronic
1068139282 10:52984337-52984359 CTCCAAGAACACATGTAGCTAGG - Intergenic
1068539584 10:58276190-58276212 CTCCAACATTGCCTGGAGCTGGG + Intronic
1069514844 10:69069445-69069467 CTCCAACACTGCATGCAGCAGGG - Intergenic
1069660837 10:70122447-70122469 TTCAAACACCAAATGGGGCTGGG + Intronic
1071693790 10:87850969-87850991 CACCAAACCCACATGGAGCAAGG - Intergenic
1072205135 10:93196993-93197015 CTCCAATCCCCCATGAAGCTTGG - Intergenic
1074185101 10:111094303-111094325 CTCCAACCCCACAAAGAGCCTGG - Intergenic
1075862614 10:125690254-125690276 CTCCAACTCTACAGGGATCTAGG + Intergenic
1076790838 10:132775871-132775893 CTCATGCACCCCATGGAGCTTGG - Intronic
1077056308 11:595513-595535 CTCCACCTGCACAGGGAGCTTGG - Intronic
1077405343 11:2380037-2380059 CACCAACACCACCAGGAGGTAGG - Intronic
1078463147 11:11530615-11530637 CTCCCAGACCACATAGAGCTGGG + Intronic
1078836529 11:15035411-15035433 CTCCAAGAGCACAGGAAGCTCGG + Intronic
1080425117 11:32147771-32147793 CTCCATCACCTCCTGGAGCAAGG + Intergenic
1083426937 11:62592992-62593014 CTCCAGCACCACTGGGAGCTGGG + Intergenic
1083562683 11:63685742-63685764 CTCCAAAACCAAGAGGAGCTTGG - Intronic
1084464737 11:69315769-69315791 ATCCATGACCTCATGGAGCTTGG + Intronic
1091618403 12:2067165-2067187 CTCCCACACCAGCTCGAGCTTGG - Intronic
1092977817 12:13762745-13762767 CTCTCACTCCATATGGAGCTGGG - Intronic
1094350271 12:29516487-29516509 CTACAAAACCACATGGACCTTGG + Intronic
1098242296 12:68480632-68480654 AACCAACACCACATGGTGGTAGG + Intergenic
1098472401 12:70860646-70860668 GTAAAACACTACATGGAGCTGGG - Intronic
1105927210 13:25018717-25018739 CGCCACCAGCACATGGAGCAGGG - Intergenic
1110238372 13:73240278-73240300 ATCCAACAGCACAGGGAGGTGGG - Intergenic
1112043595 13:95573071-95573093 CTACAGCACCACATACAGCTGGG + Intronic
1115091563 14:29583073-29583095 CTGCAGCTCCACAAGGAGCTGGG + Intronic
1122255392 14:100472413-100472435 CTACCACACCACCTGGTGCTGGG + Intronic
1125089620 15:35774891-35774913 CTCCAACACCACCTGGAGCTTGG - Intergenic
1127327081 15:57906309-57906331 CTCCCCCAACACATGGAGCCAGG + Intergenic
1127930995 15:63597502-63597524 CTCAAACACGTCGTGGAGCTGGG - Exonic
1128269047 15:66293250-66293272 CTCCATTCCCACATGGACCTGGG + Intronic
1128822458 15:70671825-70671847 CTTCATCAGCACATGGAACTAGG - Intronic
1129851841 15:78798015-78798037 CTTGTACACCACATGGGGCTGGG + Exonic
1130107624 15:80940935-80940957 CTAAAAGACCACATGGAGTTGGG - Intronic
1130251155 15:82301076-82301098 CTTGTACACCACATGGGGCTGGG - Intergenic
1131123336 15:89837075-89837097 GTCCACCCCCACATGGTGCTGGG - Intronic
1132592986 16:734487-734509 CCCCACCACCACGCGGAGCTCGG + Intronic
1135919273 16:26633943-26633965 CTCCACCAACACATGTGGCTGGG - Intergenic
1136394631 16:29986394-29986416 CTGCAGCACCAGACGGAGCTGGG + Exonic
1138200247 16:55083038-55083060 CCCCCACCCCACATGGACCTGGG - Intergenic
1146542537 17:33710048-33710070 CTCCATCAACCTATGGAGCTTGG - Intronic
1147975737 17:44247248-44247270 CTGAAACACTACCTGGAGCTTGG - Intergenic
1148684153 17:49491389-49491411 GTGCAATTCCACATGGAGCTGGG - Intergenic
1151199650 17:72458314-72458336 CTCCAACACCACACTGTGCATGG + Intergenic
1152569187 17:81114078-81114100 CTTCAGCCCCCCATGGAGCTGGG + Intronic
1153388159 18:4523112-4523134 ATCCATCACCACAGGGAGGTGGG + Intergenic
1155093923 18:22537577-22537599 CTGGAACCCCTCATGGAGCTGGG + Intergenic
1156504149 18:37578230-37578252 CTCCTGCACCACAGGCAGCTAGG + Intergenic
1156570302 18:38244876-38244898 CTCTACCTCCACATGGAGCTTGG - Intergenic
1159366719 18:67475674-67475696 TTCCAGCACCACTTGGGGCTGGG + Intergenic
1160270114 18:77376084-77376106 CTCCAAAACCATGTTGAGCTGGG - Intergenic
1160435272 18:78847353-78847375 CACCAACTCCACGTGGAGCATGG + Intergenic
1161588219 19:5117094-5117116 GTCCCACACTACATGGAACTGGG - Intronic
1161606538 19:5218257-5218279 CTCCAACCCTACATGGATCTGGG - Intronic
1161912238 19:7203161-7203183 CTCCAACACAGCCTGGATCTGGG - Intronic
1163215275 19:15871741-15871763 CTGCGGCACCACATGGAGCCCGG - Intergenic
1166407236 19:42529610-42529632 ATCCTGCACCGCATGGAGCTGGG - Intronic
1166781192 19:45344512-45344534 CTCCAATACAACATGGGGCCAGG - Intronic
1166789247 19:45388278-45388300 CACCAACACCATAGAGAGCTTGG - Intronic
1202678097 1_KI270711v1_random:25770-25792 CTCCAACACCAAACGGAGAGGGG + Intergenic
926242833 2:11101363-11101385 CTGCCATAACACATGGAGCTGGG - Intergenic
928324309 2:30307565-30307587 GTCCAGTGCCACATGGAGCTGGG + Intronic
929622981 2:43376424-43376446 CTCTAACATCACATGTAGTTTGG - Intronic
931264828 2:60651362-60651384 CCTCAACACCGCAAGGAGCTGGG - Intergenic
933676870 2:85064922-85064944 CTGCAACTCCTCATGGAGCAAGG + Intergenic
934636334 2:95992504-95992526 CGCCACCAGCACATGGAGCAGGG - Intergenic
934797309 2:97112922-97112944 CGCCACCAGCACATGGAGCAGGG + Intergenic
934836096 2:97590517-97590539 CGCCACCAGCACATGGAGCAGGG - Intergenic
936022099 2:109002600-109002622 CTCTAACCTCACATGGACCTAGG + Intergenic
938069175 2:128299555-128299577 CTCATCCACCACATGGGGCTGGG - Intronic
938290159 2:130144769-130144791 CTCGATCTCCTCATGGAGCTTGG + Exonic
938466370 2:131528176-131528198 CTCGATCTCCTCATGGAGCTTGG - Exonic
944728835 2:202498317-202498339 CTCCCAGACCACATGGAGGACGG - Intronic
946061388 2:216944646-216944668 CTCTAACACCATCTGGATCTGGG - Intergenic
947269152 2:228314262-228314284 CTCCATCATCACATGGCACTAGG - Intergenic
1173747470 20:45448776-45448798 GTCCAACATCACAGGGAGCGAGG - Intergenic
1174454195 20:50638134-50638156 CTCCAGAACCACCTGGAGCCAGG + Intronic
1174472643 20:50771911-50771933 CTCCAGAACCACCTGGAGCCAGG - Intergenic
1179343856 21:40537926-40537948 CTCCAAAACCACATGGAAGGAGG - Intronic
1179392296 21:41004842-41004864 CACCAACACCATATGCAGCAGGG + Intergenic
1180082070 21:45491497-45491519 CTCCAACACCACATGGAGCTGGG - Intronic
1180225763 21:46391230-46391252 CTCCAGCACCAGACGGTGCTCGG - Exonic
1182369966 22:29803929-29803951 TCCCAACACCTCATGGAGGTGGG + Intronic
1183232883 22:36593812-36593834 CTCCAGGAGCACTTGGAGCTCGG + Intronic
1184878164 22:47288572-47288594 TTCCACCACAACATGGATCTAGG + Intergenic
1185227505 22:49661267-49661289 TTCCAGCAGCACATGGAGCTGGG + Intergenic
951854141 3:27176242-27176264 CTTCAACAAAACAAGGAGCTTGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
955128839 3:56143178-56143200 TACCACCACCACATGAAGCTGGG - Intronic
960554015 3:119007638-119007660 CTCCAACACCACAGAAAGCAGGG + Intronic
961830254 3:129619576-129619598 CTCCATGACCACACAGAGCTGGG - Intergenic
963847906 3:150178639-150178661 AGCCAACCCCACAGGGAGCTTGG + Intergenic
965441676 3:168722406-168722428 ATACATCACCACATGGAGCTAGG + Intergenic
966114031 3:176439517-176439539 CTCGATCACCACTTGGAGATGGG + Intergenic
966944696 3:184769618-184769640 CTCAGATACCACATGCAGCTCGG - Intergenic
967776960 3:193395018-193395040 CTGCAAAGCCACAGGGAGCTTGG - Intergenic
968479804 4:828056-828078 CTCCAAGCACACCTGGAGCTGGG + Intergenic
968876771 4:3272897-3272919 TTCCAACACCACATGGTCCTGGG + Intergenic
974357297 4:60829455-60829477 TTGCAACACTACATGGAGCATGG - Intergenic
974842701 4:67316589-67316611 CCCCAACACTACATGGAATTAGG + Intergenic
977368287 4:96101530-96101552 CTCCAACCCCACATTTGGCTTGG - Intergenic
980822970 4:138040139-138040161 CTCCATCATCAGATGGAACTGGG - Intergenic
984575332 4:181441277-181441299 CTCCACAACAACTTGGAGCTGGG + Intergenic
985736800 5:1587655-1587677 CTCCAGCATCTCATGGAGCCTGG + Intergenic
985862969 5:2488688-2488710 CACCAACTCCCCATTGAGCTCGG - Intergenic
986482834 5:8205849-8205871 TTCCAAAACCACATGCAACTTGG + Intergenic
988264178 5:28928271-28928293 CGCCACCAGCACATGGAGCAGGG - Intergenic
989609437 5:43277195-43277217 CTCCATCACCAAGTGCAGCTTGG - Exonic
991032989 5:62101739-62101761 CTGCAAGACCACCTGGAGCCAGG + Intergenic
996400120 5:123053319-123053341 GTCCAACTTCACCTGGAGCTGGG - Intergenic
996530149 5:124520070-124520092 CTCACACACCACTTGCAGCTGGG - Intergenic
997260741 5:132463996-132464018 CTCCAACACCAGATGGAGGAGGG + Exonic
997997859 5:138600839-138600861 TTCCAAAACCACATGGTCCTGGG - Intergenic
1001670342 5:173468420-173468442 CTCAAAGACCACCTGGAGATAGG + Intergenic
1003460435 6:6323414-6323436 CTCCAACCCCACATGGATGAGGG - Intergenic
1005885844 6:30097120-30097142 CTCCCACACAACATGGGGCCAGG - Intergenic
1006510719 6:34519680-34519702 CTCCTACACCCCATGGGGGTAGG + Intronic
1007089088 6:39170752-39170774 CTGTAACCCCACCTGGAGCTTGG - Intergenic
1007701008 6:43766586-43766608 CTCCAGATCCACATGGGGCTAGG + Intergenic
1012781816 6:103569939-103569961 TCCCAACACCACAAGGACCTTGG + Intergenic
1018390086 6:163335508-163335530 CTGCCACACCACAGGCAGCTCGG + Intergenic
1019378256 7:707782-707804 CGCCAGCACCACCCGGAGCTGGG + Intronic
1019378284 7:707897-707919 CACCAGCACCACCTGGAGCCGGG + Intronic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1019589949 7:1825921-1825943 CTCCAACCCCGCCTGGGGCTGGG - Intronic
1019927074 7:4200263-4200285 CTCCAAGACCGCCTGGAGTTTGG - Intronic
1023610563 7:41966612-41966634 GTCCAACAACACCTGCAGCTTGG - Exonic
1030532608 7:110729484-110729506 CTCCCTCAACACATGGAGATTGG + Intronic
1033174087 7:139109173-139109195 CTCCAACACCACAAAGCGGTCGG + Exonic
1034125928 7:148671575-148671597 TTCTAATACCACATGGAACTGGG - Intergenic
1037902251 8:22694936-22694958 CTCCACCACAACGTGCAGCTCGG - Intergenic
1040277727 8:46022494-46022516 CTCCATGACCACATGGGGCCTGG + Intergenic
1040410627 8:47151101-47151123 CTCCAAAACCACATTCAGGTTGG + Intergenic
1043909501 8:85844829-85844851 CTACAACACCACCTGGCGATAGG - Intergenic
1045411589 8:101926029-101926051 CACCAAAGCCACATGGAGCTGGG - Intronic
1045411829 8:101927764-101927786 CACCAAAGCCACACGGAGCTGGG - Intronic
1045514765 8:102849011-102849033 CTTCAACACCACAGGGGGCTGGG + Intronic
1046801121 8:118428313-118428335 CCCCAACCTCACATGTAGCTGGG - Intronic
1047212551 8:122851560-122851582 GTCCTTCACCTCATGGAGCTTGG - Intronic
1049034217 8:140061899-140061921 CTCCAACATTACAGGGAGCAGGG + Intronic
1054076938 9:60545942-60545964 CGCCACCAGCACATGGAGCAGGG + Intergenic
1055609322 9:78005159-78005181 CTCCCACACCCCATGTAGCTGGG + Intronic
1058504330 9:105653280-105653302 CTCCCAGCCCACATGGACCTAGG - Intergenic
1062186392 9:135220827-135220849 GTCCAACACCTCGTGGACCTGGG + Intergenic
1062364169 9:136201153-136201175 CTTCACCATCACCTGGAGCTGGG + Intronic
1062482330 9:136758282-136758304 CACCCACACCACCTGGGGCTCGG + Intronic
1062503558 9:136861549-136861571 CTCCAACACCGCATGGCTCCTGG - Intronic
1185452736 X:291441-291463 CTCCAACACCACAGGGAAGGCGG - Intronic
1190178237 X:48168975-48168997 CTCCAACACCACACTCAGATTGG - Intergenic
1190179953 X:48183771-48183793 CTCCAACACCACAGACAGATTGG + Intergenic
1190184228 X:48220817-48220839 CTCCAACACCACACTCAGATTGG - Intronic
1190192970 X:48293008-48293030 CTCCAACACCACACTCAGATTGG + Intergenic
1190205023 X:48395679-48395701 CTCCAACACCACAGACAGATTGG - Intergenic
1190205513 X:48399724-48399746 CTCCAACACCACAGACAGATTGG + Intergenic
1190333218 X:49248300-49248322 CCCCAACCCCACCTGCAGCTTGG - Exonic
1190658871 X:52636552-52636574 CTCCAACACCACACTCAGATTGG - Intergenic
1190659481 X:52641598-52641620 CTCCAACACCACACTCAGATTGG + Intergenic
1190665708 X:52694403-52694425 CTCCAACACCACAGACAGATTGG + Intronic
1190669395 X:52726482-52726504 CTCCAACACCACAGACAGATTGG - Intergenic
1190670022 X:52731922-52731944 CTCCAACACCACAGACAGATTGG + Intergenic
1190673710 X:52764007-52764029 CTCCAACACCACAGACAGATTGG - Intronic
1193862611 X:86688854-86688876 CTCAAAGTCCACATGCAGCTAGG - Intronic
1195754769 X:108189980-108190002 CTCCAACACCAGTGGGGGCTAGG + Intronic
1198087080 X:133292030-133292052 TTCCAAGACCACATGGAATTTGG + Intergenic
1199468122 X:148163225-148163247 CTCCAACACCACAAACTGCTAGG - Intergenic