ID: 1180082630

View in Genome Browser
Species Human (GRCh38)
Location 21:45493739-45493761
Sequence GGCCGGCGGAACCGCCGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180082630 Original CRISPR GGCCGGCGGAACCGCCGACA TGG (reversed) Intronic
904351918 1:29913941-29913963 GGCCAGTGGAACCTCAGACATGG - Intergenic
905752363 1:40477259-40477281 GGCCGCCGGCTCCGCCCACAGGG - Exonic
1075185421 10:120251997-120252019 GGCCCGCGGAACAGGGGACAGGG + Intergenic
1084709409 11:70834856-70834878 GGGCGTCGGAACCTCCCACAGGG + Intronic
1118292457 14:64539586-64539608 GGCTGGCGGGACGGCAGACAGGG - Intronic
1121758675 14:96424265-96424287 CGCCGGCGGCAGCGGCGACACGG + Intronic
1122098598 14:99389397-99389419 GGCGGGCGGCACCGCCACCAGGG + Intergenic
1124014310 15:25863032-25863054 GGACGGCGGAGGCGCCGAGAGGG - Exonic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1131085903 15:89575568-89575590 GGGCGGCGGCACGGCCGATATGG + Exonic
1132815793 16:1826144-1826166 GGCGGGCGGAGGCGCAGACAGGG - Intronic
1145303654 17:21657287-21657309 GGCCGCCTGAACCTCCGCCAGGG + Intergenic
1145346390 17:22044562-22044584 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1148348749 17:46923174-46923196 GGCCTGCGGGGCCGGCGACATGG + Exonic
1162577097 19:11505488-11505510 GGCCAGCGGAGCGGCCGCCACGG - Exonic
929578553 2:43067889-43067911 GGCAGGCTGAACCCCCGCCATGG + Intergenic
932329502 2:70889641-70889663 GGCAGGAAGAACCGCGGACAGGG + Intergenic
943327661 2:186521304-186521326 AGAAGGCGGAGCCGCCGACATGG + Intergenic
945119615 2:206443917-206443939 GGCCGCAGGAAGCGCCGGCAAGG - Exonic
1171521174 20:25774972-25774994 GGCCGCCTGAACCTCCGCCAGGG + Exonic
1171555750 20:26081506-26081528 GGCCGCCTGAACCTCCGCCAGGG - Intergenic
1171782351 20:29430694-29430716 GGCCGGCTGAACCACAGCCACGG - Intergenic
1175714532 20:61246748-61246770 GGCCTGCGGGACCCCCGGCAAGG - Intergenic
1180082630 21:45493739-45493761 GGCCGGCGGAACCGCCGACATGG - Intronic
1180657697 22:17437168-17437190 GGAAGGCAGAACCGCAGACAGGG - Intronic
1184002983 22:41688793-41688815 AGCCCGCGGAACCGCAGCCATGG - Exonic
957083141 3:75655688-75655710 GGCCGGCGGAGCCACAGCCACGG + Intergenic
968481258 4:834053-834075 GGCTGGCGGAAGGGCCGACCCGG - Intergenic
972765787 4:42151690-42151712 GGCCGCCGGCACCGGCGGCACGG - Exonic
985757226 5:1726170-1726192 GGCCGGCGGAACGGCGGAGGAGG - Intergenic
1006319802 6:33313731-33313753 GACCGGGGGAACCGCCGCCCCGG - Exonic
1007596442 6:43053820-43053842 GGCTGGCGGAGCCGCTGGCAGGG - Exonic
1033186397 7:139231112-139231134 GGTCGGCGGAAGTGACGACATGG - Intronic
1035238879 7:157517387-157517409 GGTCGGGGGAGCTGCCGACAGGG + Intergenic
1062718639 9:138023486-138023508 GGCCGGCGGCACCACCGGCGCGG + Exonic