ID: 1180083032

View in Genome Browser
Species Human (GRCh38)
Location 21:45495170-45495192
Sequence ACAAGGACCCTTTTGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180083032_1180083041 -3 Left 1180083032 21:45495170-45495192 CCTCCTCCCAAAAGGGTCCTTGT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1180083041 21:45495190-45495212 TGTGCAGGAAAGGGGTGAGAAGG 0: 1
1: 0
2: 0
3: 42
4: 504
1180083032_1180083046 19 Left 1180083032 21:45495170-45495192 CCTCCTCCCAAAAGGGTCCTTGT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1180083046 21:45495212-45495234 GGCCGGGGTAGCCTGAGAGCTGG 0: 1
1: 0
2: 2
3: 15
4: 237
1180083032_1180083047 20 Left 1180083032 21:45495170-45495192 CCTCCTCCCAAAAGGGTCCTTGT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1180083047 21:45495213-45495235 GCCGGGGTAGCCTGAGAGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 211
1180083032_1180083045 4 Left 1180083032 21:45495170-45495192 CCTCCTCCCAAAAGGGTCCTTGT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1180083045 21:45495197-45495219 GAAAGGGGTGAGAAGGGCCGGGG 0: 1
1: 0
2: 3
3: 27
4: 389
1180083032_1180083044 3 Left 1180083032 21:45495170-45495192 CCTCCTCCCAAAAGGGTCCTTGT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1180083044 21:45495196-45495218 GGAAAGGGGTGAGAAGGGCCGGG 0: 1
1: 1
2: 2
3: 86
4: 786
1180083032_1180083042 -2 Left 1180083032 21:45495170-45495192 CCTCCTCCCAAAAGGGTCCTTGT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1180083042 21:45495191-45495213 GTGCAGGAAAGGGGTGAGAAGGG 0: 1
1: 0
2: 3
3: 52
4: 628
1180083032_1180083043 2 Left 1180083032 21:45495170-45495192 CCTCCTCCCAAAAGGGTCCTTGT 0: 1
1: 0
2: 0
3: 14
4: 189
Right 1180083043 21:45495195-45495217 AGGAAAGGGGTGAGAAGGGCCGG 0: 1
1: 0
2: 12
3: 138
4: 1494

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180083032 Original CRISPR ACAAGGACCCTTTTGGGAGG AGG (reversed) Intronic
900144104 1:1150549-1150571 CCAGGGCCCCATTTGGGAGGAGG + Intergenic
900922582 1:5682957-5682979 AGAAGGACCCTTTTGGAGGATGG - Intergenic
902918410 1:19652438-19652460 ACAGGAACTCATTTGGGAGGCGG + Intronic
903141124 1:21339797-21339819 AAAGGGGCCCTGTTGGGAGGAGG + Intronic
903440462 1:23384254-23384276 ACAAGGCCCCTTCTGGGTTGTGG + Intronic
904250872 1:29223304-29223326 AGAAAGAGCCTTTTGAGAGGGGG + Intronic
905366553 1:37454770-37454792 ACAAGGGCCCTTCAGGGAGTAGG - Intergenic
905919125 1:41707607-41707629 ACAAGAAGCCTATTGGGAGTTGG + Intronic
906065505 1:42977718-42977740 ACATGGACACATTGGGGAGGGGG - Intergenic
906210560 1:44010439-44010461 ACAGGGAGCCTTGTGGGCGGGGG + Intronic
907644555 1:56229285-56229307 ACAAGGCCCCTCTTGGGTCGTGG + Intergenic
909965143 1:81900240-81900262 ACAACAACCATTTTGGGAGCTGG + Intronic
910183588 1:84511384-84511406 ATAAGGACATTTTAGGGAGGGGG - Intergenic
912819744 1:112857320-112857342 ACATGGACATCTTTGGGAGGGGG - Intergenic
915138748 1:153752900-153752922 AAAAGGACCTTGTCGGGAGGAGG - Intronic
916105205 1:161424626-161424648 AATAGGATCCTTTGGGGAGGGGG - Intergenic
919366554 1:196669074-196669096 ACAAGGAACTTATTGGGAGCTGG + Intronic
919801491 1:201357273-201357295 ACAAGGACCCTGCTGGGAGAGGG + Intergenic
924707372 1:246511146-246511168 TCAAGGGCCCTGTTGGGGGGGGG + Intergenic
1063424506 10:5940906-5940928 AAAAGTTTCCTTTTGGGAGGGGG + Intronic
1069285482 10:66709293-66709315 TCAAGGCCCCTTTTGGAAGATGG - Intronic
1070652694 10:78249483-78249505 ACAAGGAATCTTTTGACAGGTGG - Intergenic
1072462196 10:95630120-95630142 ACAGAGACCCTGTTGGGAGAGGG - Intronic
1073148968 10:101298811-101298833 CCCTGGCCCCTTTTGGGAGGGGG + Intergenic
1074504189 10:114053510-114053532 ACATGTGCCCTTTCGGGAGGGGG - Intergenic
1075186918 10:120270495-120270517 ACAAGGAACCTTTTGCCATGTGG + Intergenic
1077609922 11:3637746-3637768 AAATGGACCCTTGTGGGAGCAGG + Intergenic
1085801648 11:79595280-79595302 ACAAGGTCCCTTTAAGGAGATGG + Intergenic
1086960895 11:92979403-92979425 ACAAGGACCTGCTTGGGATGTGG - Intronic
1089587121 11:119517103-119517125 ACAAGGACGGTGTGGGGAGGTGG - Intergenic
1091409460 12:229644-229666 TGAATGACCTTTTTGGGAGGGGG - Intronic
1093938483 12:25026707-25026729 ACAAAGTCTCTTTTAGGAGGTGG - Intronic
1099687507 12:85908490-85908512 ACAAGGATCCTTTGGGAGGGTGG - Intergenic
1100768019 12:97889422-97889444 ACAAGGAACCCTTTTGGGGGTGG - Intergenic
1101216426 12:102589561-102589583 TCAAGGACCCTCTCAGGAGGAGG + Intergenic
1101235028 12:102780107-102780129 ACAAGGAACTCTTTGAGAGGAGG + Intergenic
1101442407 12:104713609-104713631 AGCAGGACTCCTTTGGGAGGAGG - Intronic
1101767553 12:107716263-107716285 AAAAGGATCTTTTTGGGTGGTGG + Intergenic
1102567391 12:113805491-113805513 GCACAGACCCTTTTGGCAGGAGG + Intergenic
1103903299 12:124314646-124314668 CCAAGGACCCGTGTGGAAGGAGG + Exonic
1104399138 12:128461297-128461319 ACAAGGAGCATTGTGGGTGGGGG + Intronic
1106317527 13:28607897-28607919 AGAAGGAGACTTCTGGGAGGGGG + Intergenic
1111432529 13:88162276-88162298 AATAGGACCCTGTTGGGATGAGG - Intergenic
1111598176 13:90436975-90436997 ACAAGGACTGTTTTGAAAGGTGG + Intergenic
1113318902 13:109213289-109213311 ACAAGGGCCCATTGGGAAGGTGG - Intergenic
1113573822 13:111380664-111380686 ACAAGGAGCCTTCAGGGAGAGGG - Intergenic
1118327384 14:64790864-64790886 CCAAGGAGCCTTTAGAGAGGGGG - Intronic
1119384130 14:74246550-74246572 ACAAGAACCCAATTGGGTGGAGG - Intronic
1120965668 14:90165368-90165390 ACAAGGCCCCTCTGGAGAGGTGG - Intronic
1121072567 14:91037859-91037881 AGAAGGAACATTTAGGGAGGTGG - Intronic
1121512424 14:94522319-94522341 CCAAGGACGCTTTTGTGGGGTGG - Intergenic
1122714119 14:103683543-103683565 ACCAGGTCCCTGTTGGGATGTGG + Intronic
1124343316 15:28903817-28903839 GGAAGGACCCTTCTGGAAGGCGG + Intronic
1124797282 15:32794140-32794162 ACAAAAACCCTATTGGTAGGTGG + Intronic
1127380186 15:58424268-58424290 GCAAGGACAGTTTGGGGAGGGGG - Intronic
1128072667 15:64807333-64807355 TCAAGGCTCATTTTGGGAGGGGG + Intergenic
1128269450 15:66295195-66295217 AAAAGGTCCCTTGTCGGAGGGGG + Intronic
1128687134 15:69695189-69695211 CCATGGCCCCTCTTGGGAGGAGG + Intergenic
1129084511 15:73074664-73074686 ACATGGCCCTTTATGGGAGGGGG + Intronic
1129469359 15:75742081-75742103 ACAAGGAACTTGTTGGGAAGTGG + Intergenic
1129987831 15:79934342-79934364 ACAAGGTCCCTTTTAAGAGTAGG + Intergenic
1131309239 15:91272786-91272808 CCAAGGCTCCTTTGGGGAGGGGG + Intronic
1131502451 15:92982229-92982251 ACAAGTACACTTTAGGGAAGAGG + Intronic
1132715416 16:1287783-1287805 ACAAAGTGCCTGTTGGGAGGTGG + Intergenic
1137540301 16:49357120-49357142 AAGAGGACCCTGGTGGGAGGAGG - Intergenic
1137622290 16:49883937-49883959 ACTAGGACAACTTTGGGAGGAGG - Intergenic
1138217604 16:55218301-55218323 ATCAGGACCCTCTTGGGATGGGG + Intergenic
1138301947 16:55937789-55937811 AAGAGGACCCTTTTGGGAAAGGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142656514 17:1398336-1398358 ACAAGGTTCCTGTTGGGGGGGGG - Intronic
1143623180 17:8092787-8092809 ATAAAGATCCTTTTGGGCGGTGG - Intergenic
1143706051 17:8698334-8698356 TCAAGGAAGCTTCTGGGAGGAGG + Intergenic
1145281582 17:21471405-21471427 AAAAGGAACCTTTTGTGATGTGG - Intergenic
1146468721 17:33107770-33107792 GGAAGGACCTTTTGGGGAGGTGG - Intronic
1148036024 17:44660755-44660777 ACATGGTCCCTTTTGGAAGGAGG + Intronic
1148785976 17:50146424-50146446 ACAAGGGCCCTTGGGGGAGATGG - Intronic
1151474762 17:74339194-74339216 ACAAGGCCCCTCGTGGGAGTAGG + Intronic
1153349032 18:4058540-4058562 ATTAGCACCCCTTTGGGAGGAGG + Intronic
1154094007 18:11393482-11393504 ACAAGGATCCATTGGGAAGGTGG + Intergenic
1154302038 18:13202898-13202920 AAAAGCATCATTTTGGGAGGAGG - Intergenic
1155357323 18:24965850-24965872 ACAAGGACAATTTTGGCAGGTGG + Intergenic
1155999920 18:32373311-32373333 ACTAAGTCCCATTTGGGAGGAGG + Intronic
1157790760 18:50528976-50528998 ACAAGGACCCCTCTGGAATGAGG - Intergenic
1158611749 18:58946757-58946779 ACAAGTACCCTTGGGGGAGGGGG - Intronic
1159613906 18:70557384-70557406 CCAAGGAACCTTTTGGGTGTTGG + Intergenic
1159696225 18:71559758-71559780 ACATGGACACTTTTGGGAGAAGG + Intergenic
1164585991 19:29476360-29476382 ACAAGGACCCCTGTGGGCTGAGG - Intergenic
1168137984 19:54364521-54364543 AGCAGGAGCCTTTTTGGAGGAGG - Intronic
925967056 2:9075886-9075908 GGAAGGACCCTTCTGGGATGAGG - Intergenic
926795788 2:16617792-16617814 TCAAGGACTCTTTTGGGAGTTGG + Intronic
931245484 2:60489238-60489260 ACAAGGACCCCATTGGCATGTGG - Intronic
931791513 2:65667751-65667773 CCGGGGACCCTTTGGGGAGGAGG + Intergenic
933678109 2:85075945-85075967 ACAAGGTCTGTCTTGGGAGGTGG - Intergenic
935264652 2:101384027-101384049 ACAATGACATTTATGGGAGGTGG + Intronic
935948194 2:108304915-108304937 ACAAGGACACCTTTTGGAAGAGG - Intronic
941856292 2:170234465-170234487 AGGTGGATCCTTTTGGGAGGTGG - Intronic
948514683 2:238496760-238496782 ATGAGGACCCTTTGGGGAGGAGG + Intergenic
948630780 2:239301186-239301208 AGAAGGCCCCTTCTGGAAGGGGG + Intronic
948977225 2:241471105-241471127 AGAAGGACCCTGTTCTGAGGAGG + Intronic
1168916048 20:1489218-1489240 ACAAGGAAACTTTTGGGCGCTGG + Intronic
1169843978 20:9970100-9970122 ACTAGGAAGCTTTTGGGAGCTGG + Intergenic
1174146243 20:48454750-48454772 TCCAGGACCCTTCTGGGAAGGGG - Intergenic
1174757746 20:53176356-53176378 GCTAGAATCCTTTTGGGAGGAGG + Intronic
1174786382 20:53437010-53437032 ACCAGGAGCCTTTCTGGAGGAGG - Intronic
1176340773 21:5693185-5693207 GCAAGGTCCCTTTGGGGAGCAGG + Intergenic
1176473027 21:7125338-7125360 GCAAGGTCCCTTTGGGGAGCAGG + Intergenic
1176504054 21:7631271-7631293 GCAAGGTCCCTTTGGGGAGCAGG - Intergenic
1176720997 21:10392577-10392599 AGAAGAACCCCTTTGGGAAGAGG + Intergenic
1179565495 21:42245304-42245326 ACAAGGAACCTGTTGGGTTGTGG + Intronic
1180083032 21:45495170-45495192 ACAAGGACCCTTTTGGGAGGAGG - Intronic
1180302185 22:11045367-11045389 AGAAGAACCCCTTTGGGAAGAGG + Intergenic
1181570996 22:23767800-23767822 ACAAGGGCCCTGTGGGGAGGGGG - Intronic
1182311269 22:29409502-29409524 ACAAGGAGCCTTGGGGGATGTGG - Intronic
1182377028 22:29856153-29856175 CCAAGGGCCCTATTAGGAGGAGG - Intergenic
1182689707 22:32150529-32150551 ACAAGGAGCCTTGGGGGATGTGG + Intronic
1182713415 22:32336497-32336519 ACAAGCCCCCTCCTGGGAGGTGG - Intergenic
1183274087 22:36880630-36880652 AAGTGGACCCTTATGGGAGGTGG + Intergenic
1183848975 22:40567188-40567210 TCAAGCAGCCTTTTTGGAGGTGG - Intronic
1183977847 22:41523544-41523566 AGCAGGAGCCGTTTGGGAGGAGG + Intronic
1184446524 22:44550735-44550757 ACAATGAGCATTGTGGGAGGAGG + Intergenic
1203240038 22_KI270733v1_random:7643-7665 GCAAGGTCCCTTTGGGGAGCAGG + Intergenic
950019840 3:9779501-9779523 ACCTGGACCCTTGGGGGAGGGGG + Intronic
951599016 3:24351956-24351978 ACAAAGACACTTTTTGGAAGAGG + Intronic
952173247 3:30833194-30833216 ATAAGGATCCTTGTGGGAAGTGG - Intronic
953158770 3:40398966-40398988 ACCAGCAGCATTTTGGGAGGCGG + Intronic
954855280 3:53638841-53638863 CCGAGGACCCATCTGGGAGGTGG - Intronic
955741456 3:62095313-62095335 ACAAGGAGATTTTTGTGAGGTGG + Intronic
959632312 3:108521123-108521145 AAAATTACACTTTTGGGAGGGGG - Intronic
962375355 3:134854315-134854337 GAAAGGAGCCGTTTGGGAGGAGG + Intronic
962447582 3:135480964-135480986 ACAAGTATCCTTATGGGAAGAGG - Intergenic
962896790 3:139722743-139722765 GCCAGGACCTTTTTGGGAGGAGG + Intergenic
963548081 3:146686122-146686144 ATAAGGAACCTGTTGGGAAGTGG - Intergenic
963802262 3:149687910-149687932 ACAAGGACCCTTTAGTAAGCAGG - Intronic
964260587 3:154831132-154831154 AGAATGATCCTTTTGGCAGGAGG - Intergenic
964797366 3:160513885-160513907 ACAAGAAACTTTTTGGGGGGTGG - Intronic
965544608 3:169902942-169902964 GCAAGGTACCTTTTGGGAGCAGG - Intergenic
974550118 4:63361420-63361442 GCAAGAACCCTTTTGGAATGAGG - Intergenic
977377587 4:96226346-96226368 ACAAGAAAACTTTTGGGTGGTGG + Intergenic
977683966 4:99826651-99826673 ACAGGGTCCCTGTTGGGAAGTGG - Intronic
977816548 4:101419880-101419902 ACAAAGAAACTTTAGGGAGGTGG - Intronic
978411119 4:108426960-108426982 GTAAGGAACCTTTTGTGAGGGGG + Intergenic
982309849 4:153973553-153973575 AGAAGGAGCCTGGTGGGAGGTGG + Intergenic
984494286 4:180475211-180475233 ACAAGCACATCTTTGGGAGGTGG - Intergenic
984909407 4:184658543-184658565 AGAAGAACCCTTATGGCAGGAGG + Intronic
984933275 4:184867247-184867269 ACAAGGGTCCTTATGAGAGGAGG + Intergenic
985006273 4:185537835-185537857 ACAAGCATCATTCTGGGAGGTGG + Intergenic
986354477 5:6910163-6910185 AGCAGGACCCTTTAGGGAGGAGG - Intergenic
987349885 5:17012386-17012408 ACAAGGATCCTTTGGAGTGGAGG - Intergenic
988371844 5:30380230-30380252 AGAGAGACCCTTTTGGGAAGTGG + Intergenic
989181300 5:38580176-38580198 ACAAGGATGCATTTGGGTGGAGG - Intronic
991400338 5:66245127-66245149 ACAAGGATGCTTTTTGGAGCTGG + Intergenic
994730098 5:103481675-103481697 AGAAAGGCCCTGTTGGGAGGTGG - Intergenic
996870848 5:128191757-128191779 ACAAGGACAGTTTGGGAAGGAGG + Intergenic
998154017 5:139774231-139774253 CAAAGGACTCTTTGGGGAGGTGG + Intergenic
1001134230 5:169089245-169089267 GTAAGGACCTCTTTGGGAGGTGG + Intronic
1001642976 5:173258321-173258343 ACAAGGTCTCTTGAGGGAGGAGG - Intergenic
1005251884 6:23956276-23956298 ACAATGTCCTTTTTGGGAGGTGG - Intergenic
1006369463 6:33634887-33634909 ACAGGGACCCTCTGAGGAGGGGG + Intronic
1008372147 6:50744952-50744974 AAAAAGACCTTTTTGGGGGGAGG - Intronic
1011756631 6:90505827-90505849 ACAAGGAATCTTTTGGGATTGGG + Intergenic
1017523184 6:155220080-155220102 CCAAGGACCCACTTGGCAGGAGG - Intronic
1017929261 6:158938333-158938355 ACAGGGCACCTGTTGGGAGGTGG + Intergenic
1018917774 6:168147478-168147500 ACTGGGAACCTTTTGGGAGGTGG + Intergenic
1020764580 7:12303908-12303930 GCCAGCACCCCTTTGGGAGGAGG + Intergenic
1024830678 7:53451708-53451730 ACAAGGACACGTTAGAGAGGTGG - Intergenic
1025202912 7:56973119-56973141 ACAATGGCCCTTTGAGGAGGAGG - Intergenic
1025669032 7:63603807-63603829 ACAATGGCCCTTTGAGGAGGAGG + Intergenic
1026369732 7:69687026-69687048 ACAAGTACTCTTTTTGGAGTTGG + Intronic
1028394154 7:90348800-90348822 ACATGGACCCTTCTGTGAAGAGG - Intronic
1028564388 7:92212210-92212232 ACAAGAACCTTTTGGGGAGCAGG - Intronic
1032111840 7:129082568-129082590 AAGAGGACACTTCTGGGAGGTGG - Intergenic
1033773833 7:144583960-144583982 ACAATGCGCCTTTTGGAAGGCGG + Intronic
1035903748 8:3486845-3486867 CCAAGAACCCTGTTGGTAGGGGG - Intronic
1036279989 8:7392639-7392661 ATAAGGACCCTTATGGGTGATGG + Intergenic
1036341536 8:7919244-7919266 ATAAGGACCCTTATGGGTGATGG - Intergenic
1038324989 8:26566331-26566353 GCAGGGCCCCTTTAGGGAGGGGG - Intronic
1038372003 8:27003390-27003412 ACAAAGACTCTTAGGGGAGGAGG + Intergenic
1040932212 8:52747192-52747214 ACACTGGCCCTTGTGGGAGGGGG - Intergenic
1041436393 8:57846690-57846712 AAATGGATCTTTTTGGGAGGAGG + Intergenic
1041644384 8:60236613-60236635 ACATGATCCCTTTGGGGAGGGGG + Intronic
1041955538 8:63554755-63554777 ACAAGGAACATTTTGGAAAGTGG - Intergenic
1043484713 8:80687616-80687638 ACAATGTGGCTTTTGGGAGGGGG - Intronic
1048816814 8:138341809-138341831 ACAAGGACCCTCTCAGCAGGGGG + Intronic
1049769366 8:144372816-144372838 ACGAGGAGCCATGTGGGAGGAGG + Intergenic
1049985876 9:950517-950539 ACAAAAACCCTTTGGGGAGGTGG - Intronic
1050095126 9:2056928-2056950 AAATGGACCCTTGTGGGTGGTGG + Intronic
1050258888 9:3820549-3820571 ACAAGGAGCCTTTTGGAAATAGG + Intergenic
1051310819 9:15769379-15769401 CCATGGACCCTTTTGAGAAGAGG - Intronic
1052337778 9:27337457-27337479 CTGAGGACCCTGTTGGGAGGGGG - Intronic
1057265618 9:93615731-93615753 ATAAGGAACCTGTGGGGAGGAGG - Intronic
1057869352 9:98707220-98707242 TGCAGAACCCTTTTGGGAGGAGG - Intronic
1059434275 9:114266855-114266877 ACCAGGACCCTTGTGGGGGTTGG + Intronic
1060127261 9:121060121-121060143 GCAAGGACCTATTTGGGTGGTGG - Intergenic
1060154388 9:121309065-121309087 ACGAGCACCCGATTGGGAGGAGG + Intronic
1061734858 9:132647324-132647346 CAAAGAACCCTTTTGGGAGGTGG - Intronic
1203422294 Un_GL000195v1:4808-4830 GCAAGGTCCCTTTGGGGAGCAGG - Intergenic
1189160750 X:38805708-38805730 CCAAGGAACCTCCTGGGAGGGGG + Exonic
1190252323 X:48736665-48736687 ACAAGGAGAATTTTGGAAGGTGG - Intergenic
1194049916 X:89055744-89055766 AGAAGCACACTTTTGGGGGGTGG + Intergenic
1195164587 X:102206624-102206646 ACAAAGACCCTTTTAGATGGTGG - Intergenic
1195194272 X:102480470-102480492 ACAAAGACCCTTTTAGATGGTGG + Intergenic
1196339379 X:114580329-114580351 ACTGGAAGCCTTTTGGGAGGGGG - Intergenic
1196339392 X:114580386-114580408 ACTGGAAGCCTTTTGGGAGGGGG - Intergenic
1202043475 Y:20712499-20712521 ACACTGAGCCTTTTGGGGGGTGG + Intergenic