ID: 1180083743

View in Genome Browser
Species Human (GRCh38)
Location 21:45498220-45498242
Sequence GTTTGAGGATGTCTGGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 266}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180083736_1180083743 15 Left 1180083736 21:45498182-45498204 CCACTGAGAACAGCTGGATAAAA 0: 1
1: 0
2: 2
3: 25
4: 260
Right 1180083743 21:45498220-45498242 GTTTGAGGATGTCTGGGGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 266
1180083734_1180083743 21 Left 1180083734 21:45498176-45498198 CCAAGACCACTGAGAACAGCTGG 0: 1
1: 0
2: 2
3: 21
4: 247
Right 1180083743 21:45498220-45498242 GTTTGAGGATGTCTGGGGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 266
1180083733_1180083743 25 Left 1180083733 21:45498172-45498194 CCTGCCAAGACCACTGAGAACAG 0: 1
1: 0
2: 2
3: 19
4: 213
Right 1180083743 21:45498220-45498242 GTTTGAGGATGTCTGGGGGCTGG 0: 1
1: 0
2: 1
3: 19
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180083743 Original CRISPR GTTTGAGGATGTCTGGGGGC TGG Intronic
900370686 1:2330815-2330837 GAATGAGGATTTCTGGGGCCAGG + Intronic
901372970 1:8816787-8816809 GTTTGTGGATTTCGGGGTGCTGG - Intronic
901432527 1:9225771-9225793 TTTTGAGGCTGCCTGGGGGAAGG - Intergenic
902177245 1:14659844-14659866 TTTTGAAGATTGCTGGGGGCTGG - Intronic
902323528 1:15684166-15684188 ACTTGAGGAGGGCTGGGGGCGGG + Intergenic
902836033 1:19047335-19047357 GTTTGGGAATGCCTGGGGGAAGG + Intergenic
904985061 1:34539015-34539037 GTATGAGGTTGTCGGGGGACAGG - Intergenic
905199735 1:36307516-36307538 GATTGAGGACGGCTGGTGGCTGG + Exonic
905865968 1:41377014-41377036 CTCTGTGGATATCTGGGGGCAGG + Intronic
906607665 1:47183071-47183093 GATGAAGGATGTTTGGGGGCGGG + Intergenic
906792513 1:48670997-48671019 GTTTGAGGAGGCAAGGGGGCTGG + Intronic
907680622 1:56560041-56560063 GTTTGAGGGGCTCTGGGGGAAGG - Intronic
907964914 1:59319693-59319715 GTTTGAGGATGTCTGTAGCCTGG + Intronic
908762452 1:67524634-67524656 GCTTGAGGGTTTCTGTGGGCTGG + Intergenic
908774094 1:67623873-67623895 GTGTGAGGATGGCTTGGGCCTGG - Intergenic
912566808 1:110593271-110593293 GCTGGAGGATGTGTGGGGGCGGG - Intergenic
913470700 1:119182648-119182670 GTGTGAGGCTGTCTGGGGAATGG - Intergenic
913511618 1:119567786-119567808 GTTTGAGGATGGCTAGAGTCAGG - Intergenic
914833721 1:151190101-151190123 GTATGAGTTTGGCTGGGGGCCGG - Exonic
915496621 1:156286414-156286436 GTTTGAGGGTATCCTGGGGCAGG - Exonic
915681180 1:157583352-157583374 GACTGAGGATGTCTGGGGTAGGG - Intronic
916904040 1:169262443-169262465 GTTTTTGGATATCTGGGGGCAGG + Intronic
918050369 1:180968078-180968100 GTTTGGGGGTATTTGGGGGCAGG + Intergenic
918275048 1:182945829-182945851 GTGGGAGGATGTCTTGAGGCCGG + Intronic
919296603 1:195709653-195709675 GTTTGAGAATGACTGGATGCTGG + Intergenic
920366854 1:205452481-205452503 GTTTGATGATCTCTGGTGACAGG - Intronic
921255065 1:213331621-213331643 GTCTGCAGATGTTTGGGGGCTGG + Intergenic
921640570 1:217547821-217547843 GTCAGAGGAGGTCTGGCGGCGGG + Intronic
922218221 1:223538244-223538266 CTGTGAGGATGTCTGGAGGGGGG - Intronic
922343839 1:224679788-224679810 GATTGGGGACATCTGGGGGCGGG + Intronic
923393421 1:233536293-233536315 GTTTGAGGTGGGGTGGGGGCGGG + Intergenic
924037566 1:239953046-239953068 GTGTGAGGAGGCCTGGGGGTGGG - Intergenic
1065199736 10:23301351-23301373 GTGTGAGGCTGTCTGGGGAAGGG - Intronic
1066453701 10:35554107-35554129 ATCTGAGGATTACTGGGGGCAGG - Intronic
1069372013 10:67758118-67758140 GAATGCTGATGTCTGGGGGCAGG - Intergenic
1069731937 10:70622719-70622741 CTTTGAGGAGGTCTGGGAGCAGG + Intergenic
1069739631 10:70679258-70679280 TCTTGAGGATGTCCAGGGGCAGG + Intronic
1071327322 10:84530130-84530152 GTGTGAGGCTGTCTGGGGAAGGG - Intergenic
1073329328 10:102660520-102660542 GGTGCAGGATGCCTGGGGGCAGG + Intergenic
1074757374 10:116634582-116634604 GAATGAGGAGGGCTGGGGGCTGG - Intronic
1075474582 10:122723261-122723283 GTTTAATGATTTCTGGGAGCCGG + Intergenic
1075783344 10:125031541-125031563 GGTTGAGGACGTTCGGGGGCAGG - Intronic
1076103899 10:127804803-127804825 GTTTGAATTTGTCTAGGGGCAGG - Intergenic
1076772776 10:132675688-132675710 GTTTTAGCATTTCTGGGGACCGG + Intronic
1077870930 11:6260574-6260596 TTTTTGGGATGGCTGGGGGCTGG - Intronic
1079003722 11:16778323-16778345 GCTGGAGGAAGCCTGGGGGCAGG + Intronic
1081135249 11:39432324-39432346 GTATCAGAATGTCTGGGGGCTGG + Intergenic
1081819370 11:45976746-45976768 GTGGGAGGATGGCTTGGGGCAGG + Intronic
1083295194 11:61711503-61711525 GTCAGAGGAAGGCTGGGGGCAGG + Intronic
1084128917 11:67118866-67118888 GTGTGAGGGTGTGTGGGGGGAGG + Intergenic
1084694022 11:70743285-70743307 GTGTGAGGGTGTCTGGAGGTGGG + Intronic
1084788507 11:71458328-71458350 GTCTGAACGTGTCTGGGGGCCGG - Intronic
1085204737 11:74724565-74724587 GTAGGAGGAGGCCTGGGGGCTGG - Intronic
1085278294 11:75314053-75314075 GCTGGAGGGTGTGTGGGGGCAGG - Intronic
1088282265 11:108147263-108147285 ATTTTAGGATGTCTGGAGCCAGG + Exonic
1088635551 11:111816854-111816876 GTTTAAGAATGACTTGGGGCTGG - Intronic
1088797282 11:113274428-113274450 GTCTGAGGATGCATGGGGACAGG - Intronic
1089086235 11:115819233-115819255 GTTGGAGGATGTTTAGGGGAAGG + Intergenic
1092205776 12:6613584-6613606 GGTTGAGGAGGTGGGGGGGCTGG + Intergenic
1094731913 12:33186460-33186482 GTCTCAGGTTGGCTGGGGGCTGG + Intergenic
1100957483 12:99925076-99925098 GTGCGAGGGTGGCTGGGGGCTGG + Intronic
1101584378 12:106071867-106071889 GTTTGAGAGTGTTTGGGGGCAGG - Intronic
1101650645 12:106674212-106674234 CTTTGTGGATATCTGGGGGAAGG - Intronic
1101883061 12:108639009-108639031 GTTTGAGGAGGCCAGGGGCCTGG + Intergenic
1102976259 12:117209062-117209084 ATTTGAGGGTGTCCGGGGGAGGG - Exonic
1103007646 12:117435033-117435055 GTGTGAGGCTGTGTGGGGGGTGG - Intronic
1103889830 12:124230082-124230104 TCTTGAGAATGTCTGTGGGCTGG + Intronic
1104993818 12:132641956-132641978 GTGTGAGGATGGGTGTGGGCAGG - Intronic
1105669865 13:22601021-22601043 GTTTGGGGATGTGTGGAGACTGG - Intergenic
1108003325 13:45924260-45924282 GTTTCTGTAAGTCTGGGGGCGGG - Intergenic
1110040226 13:70745632-70745654 GTTAGAGGATGTTTGGGCACTGG + Intergenic
1110520590 13:76471559-76471581 GTTTGGTAATGTGTGGGGGCAGG - Intergenic
1111021540 13:82458245-82458267 GTGTGAGGCTGTCTGGGGAAGGG + Intergenic
1112804335 13:103146521-103146543 GGTTGTGCATGTATGGGGGCAGG - Intergenic
1114618656 14:24081901-24081923 GTTGGGGGCTGTCTGGGTGCGGG - Intronic
1116582824 14:46663673-46663695 GTTGGAGGCTGTCTGGGCCCAGG + Intergenic
1117803976 14:59470936-59470958 GTGTGGGGGTGGCTGGGGGCGGG + Intronic
1119282284 14:73419731-73419753 GTCTGAGGATGTTAAGGGGCAGG - Intronic
1119769283 14:77210443-77210465 GTTTGAGGATGGTATGGGGCAGG + Intronic
1121599188 14:95190533-95190555 GGCTGAGGAAGACTGGGGGCAGG + Exonic
1122721116 14:103723220-103723242 GCTAGTGGATGTCTGGGGTCAGG + Intronic
1122765142 14:104063713-104063735 GTATGTGGAGGTCTGGGTGCTGG + Intergenic
1122893313 14:104742907-104742929 GTGTGGGGATGTCCGGGAGCTGG + Intronic
1125133799 15:36316237-36316259 TTATGAGGGTGTCTGGGGGTGGG + Intergenic
1125598395 15:40902032-40902054 GAATCAGAATGTCTGGGGGCAGG + Intronic
1128224683 15:65993632-65993654 GTCTCAGGCTGTGTGGGGGCGGG + Intronic
1128788239 15:70414078-70414100 GATTCAGGAGGTCTGGGGACAGG - Intergenic
1129661730 15:77556532-77556554 GTCTGGGCATGTCTGGGAGCAGG - Intergenic
1129935308 15:79443245-79443267 GTTTGAATATTTCTGAGGGCTGG + Intronic
1130041517 15:80408984-80409006 GGTTGTGCATGTGTGGGGGCAGG - Intronic
1130542691 15:84833256-84833278 ATGTGAGGATGAGTGGGGGCAGG - Intronic
1130891422 15:88136988-88137010 CTTTGAGAATGTCTGGGGATGGG - Intronic
1131420215 15:92298826-92298848 GTGTGAGGCTGTCTGGGGAAGGG + Intergenic
1132064188 15:98716857-98716879 TTTTCAGGATGTCATGGGGCTGG + Intronic
1132877034 16:2144530-2144552 GTGTAAGGATGCCAGGGGGCCGG + Intronic
1133040106 16:3056159-3056181 GCTTGAGGAGGGATGGGGGCAGG + Intronic
1133043983 16:3076004-3076026 GCTTGAGGAGGGATGGGGGCAGG + Intronic
1133073420 16:3262013-3262035 GTTTGAGGAAGAGTGGTGGCTGG + Intergenic
1133290054 16:4714389-4714411 GGATGAGGAGGGCTGGGGGCTGG + Intronic
1133910786 16:10064408-10064430 GTTTGAGGATCTCTGGTGCAGGG - Intronic
1135407933 16:22211455-22211477 TTTTTCGGAGGTCTGGGGGCGGG + Intronic
1136229813 16:28879590-28879612 GTGGGAGGGTCTCTGGGGGCTGG + Intronic
1136567765 16:31080313-31080335 GTTGGAGTAGGTCTTGGGGCAGG - Exonic
1139421237 16:66850727-66850749 GCTTGAGGATGCCTGGGGTCGGG + Intronic
1139710006 16:68768916-68768938 GCATGAGGATGCCTGGGGGAAGG - Intronic
1140410611 16:74738478-74738500 GTCTGAGGCTGGCTGGGGACGGG - Intronic
1141766193 16:86061466-86061488 GTGTGAGGGTGACTGGGGGCGGG - Intergenic
1141817684 16:86424091-86424113 GTTTGTGTTTGTCTAGGGGCTGG - Intergenic
1142380714 16:89730421-89730443 GTGTGAGGAGGGCTGGGAGCTGG + Intronic
1143017184 17:3897182-3897204 GGTTCAGGAGGTCTGGGGGTGGG + Exonic
1144729884 17:17520166-17520188 GAGTGTGGATGCCTGGGGGCTGG + Intronic
1146446984 17:32939962-32939984 GTATGCGCATGTCTGGTGGCAGG - Intronic
1147150721 17:38512005-38512027 GAGTGAGGGTGTGTGGGGGCTGG - Exonic
1147733641 17:42619920-42619942 ATGTGAAGATTTCTGGGGGCGGG - Intergenic
1147959482 17:44157749-44157771 GTTTGAGGTTGTCTGGGTAGAGG + Intronic
1148619765 17:49025750-49025772 GATTGGGGAGGTCTGGGGCCAGG + Intronic
1149660148 17:58330598-58330620 GTTTGGGTATGTAGGGGGGCAGG + Intergenic
1150831973 17:68530383-68530405 GTTTGAGGATGTCTGAGCATGGG - Exonic
1151508911 17:74546443-74546465 GTGTGTGTAGGTCTGGGGGCAGG - Intergenic
1152474409 17:80508720-80508742 GTCTGAGGATGTCTCGGGGCAGG - Intergenic
1152481271 17:80555148-80555170 GCTTGAGGATATCAGGTGGCTGG + Intronic
1153137151 18:1929868-1929890 TGTGGAGGATGTGTGGGGGCAGG - Intergenic
1153617192 18:6945935-6945957 CTTTGGGGCTGTCTGGGCGCAGG - Intronic
1154122614 18:11663973-11663995 GGGTGAGGCTGTCTGGGGGATGG + Intergenic
1160756340 19:758803-758825 GTTTGAGGCTGTCAAAGGGCTGG + Intronic
1160948573 19:1654792-1654814 GTCTGAGGGTGTCTGTGGCCGGG + Intergenic
1161225371 19:3142252-3142274 GCTGGGGGATGTCTGGGGGTCGG + Intronic
1161846211 19:6713294-6713316 GATTGAGGATGGCTCGGGGGAGG - Exonic
1161990823 19:7683081-7683103 GTTGGAGGCTGTCTGCAGGCTGG + Exonic
1163126497 19:15246995-15247017 GTGTGGGGGTGTCTTGGGGCTGG - Intronic
1163826185 19:19526128-19526150 GGAGGAGGGTGTCTGGGGGCGGG + Intronic
1165480425 19:36060302-36060324 GATGGAGGATGTCTTCGGGCAGG + Intronic
1166133996 19:40764243-40764265 GTTGGAGGGTGTCTGGGAGAAGG + Intronic
1167089139 19:47331415-47331437 GTGTGAGGATGGCTTGAGGCTGG + Intergenic
925643770 2:6013442-6013464 GTTAGAGGTTGTCTGGGGTTTGG - Intergenic
925872923 2:8286202-8286224 GTGTGATGATGTTTGGGGACAGG - Intergenic
925905445 2:8537216-8537238 GGGTCAGGATGTGTGGGGGCTGG - Intergenic
926108909 2:10169814-10169836 ATCTGAGGAAGTCTGGGAGCTGG + Intronic
927276362 2:21265709-21265731 GTTTCAGTGTGTCTGGGAGCTGG - Intergenic
927717041 2:25359732-25359754 ATTTCAAGATGTCTGGGGACAGG - Intergenic
927774338 2:25890533-25890555 GTGGGAGGATCTCTTGGGGCTGG + Intergenic
927869601 2:26615264-26615286 GTTTCATGCTGTCTGGGGGCAGG - Intronic
932600714 2:73123337-73123359 GTTTGAGGGAGTTTGGGGGAAGG - Intronic
933175636 2:79169654-79169676 GTGTGAGGCTGTCTGGGGAAGGG - Intergenic
936232032 2:110711431-110711453 CTCTGAGGATGTCTGGAGCCAGG - Intergenic
939502151 2:143001257-143001279 GTGTGAGGATGGCTGGGGTAGGG - Intronic
946688369 2:222293373-222293395 GTTTGAGGATGGCTTGCGGCAGG + Intronic
947076009 2:226346829-226346851 GAGTGCTGATGTCTGGGGGCAGG - Intergenic
947841883 2:233213007-233213029 ATTTGGGAATGTCTGGGGGTGGG - Intronic
947935957 2:234003811-234003833 GGTTGAGGATGTGTGGGAGGAGG + Intronic
1169551495 20:6706125-6706147 GTTTGGGCATTTCTGGGGCCAGG - Intergenic
1170667291 20:18397712-18397734 GTGGTTGGATGTCTGGGGGCGGG + Intronic
1172938985 20:38641715-38641737 GGTTGGGGATGTCTGCGGGAAGG - Exonic
1173139313 20:40468252-40468274 GTAAGAGGATGTCTGGGTGGTGG - Intergenic
1173856202 20:46252048-46252070 GGTGGGGGATTTCTGGGGGCTGG - Intronic
1174114075 20:48214842-48214864 GCGTGAGGAAGTCTGGGGGAGGG + Intergenic
1174630310 20:51951412-51951434 GCATAAGGATGTCTAGGGGCAGG - Intergenic
1174846819 20:53950436-53950458 GCCTGAGTGTGTCTGGGGGCGGG - Intronic
1180017620 21:45097615-45097637 TTCTGAGGATGCCTGGGTGCTGG + Intronic
1180083743 21:45498220-45498242 GTTTGAGGATGTCTGGGGGCTGG + Intronic
1181587014 22:23858260-23858282 GATTTAGCATCTCTGGGGGCTGG - Intronic
1182259475 22:29062899-29062921 GTTTGCGAATGTCTGGAGACTGG + Intergenic
1182423137 22:30258069-30258091 GTCTCAGGACGTCTGAGGGCTGG - Intergenic
1182552387 22:31107282-31107304 GTTCGAGGTGGTCTTGGGGCCGG + Intronic
1182572483 22:31249399-31249421 GACTGAGGAGGTGTGGGGGCTGG - Intronic
1184178186 22:42801704-42801726 GTTTGAGGATGAATGGGTGGAGG - Intronic
949815753 3:8056166-8056188 GTGGGGGGATATCTGGGGGCAGG - Intergenic
951989741 3:28663412-28663434 GGATGAGGTTCTCTGGGGGCTGG + Intergenic
952669026 3:35943933-35943955 GGCTGAGGATGTGTGGTGGCAGG + Intergenic
953101626 3:39835340-39835362 CTTTGAGAATTGCTGGGGGCGGG + Intronic
953998988 3:47541459-47541481 GTTTGAGAATGTGCTGGGGCCGG - Intergenic
955391963 3:58528592-58528614 GTTTGTAGCTCTCTGGGGGCTGG + Intronic
955678942 3:61480182-61480204 GTGGGAGGATGTCTTGAGGCCGG + Intergenic
955971355 3:64441649-64441671 GATTGAGGAGGTCTGGGGCAGGG + Intronic
956151892 3:66252401-66252423 ATTTGAGGATGTCTGTAGGGAGG + Intronic
959297025 3:104548741-104548763 GTTTGAGGATATCTGGGAGTAGG + Intergenic
959529727 3:107419928-107419950 GGTTGTGGATGTTTGGGGACAGG + Intergenic
959557663 3:107740479-107740501 GTCTGGGGATGACTGGAGGCAGG - Intronic
960160526 3:114345687-114345709 GATTTAGGATGTCTGGGGTGGGG + Intronic
961028286 3:123580380-123580402 GTGGGAGGATGGCTGGGGCCTGG + Intronic
961764909 3:129202218-129202240 GTTTATGCATGTGTGGGGGCAGG - Intergenic
962327459 3:134447702-134447724 CTTGGAGGATGTCTGGGAGCTGG + Intergenic
962776468 3:138665660-138665682 GTGAGAGGATGGCTGGAGGCTGG - Intronic
964818814 3:160747395-160747417 TTTTCAGTTTGTCTGGGGGCGGG - Intergenic
967233936 3:187366828-187366850 GTGTGAGCATCTGTGGGGGCAGG + Intergenic
967423579 3:189300795-189300817 TATTGAGGATATCTGAGGGCTGG - Intronic
968303609 3:197634225-197634247 GTGGGAGGATGTCGGGGGGTGGG + Intergenic
968804999 4:2766598-2766620 GGATGTGGAAGTCTGGGGGCGGG - Intergenic
969267362 4:6073322-6073344 GTTGGAGGATGCCTGAGGTCTGG - Intronic
973105968 4:46337756-46337778 GTTAGAGGATGTGTGGAGCCTGG + Intronic
975314103 4:72932248-72932270 GTGTGAGGCTGTCTGGGGAAAGG - Intergenic
976812088 4:89108998-89109020 GGTTATGGATGTGTGGGGGCAGG - Intronic
977645809 4:99410319-99410341 GTGTGAGGAAGTATGGGGTCTGG + Intergenic
980092220 4:128454868-128454890 TTTTGAGCATGTATGTGGGCAGG + Intergenic
980215177 4:129843547-129843569 GTTTGTGGTTTTCTGAGGGCTGG - Intergenic
982725598 4:158902828-158902850 GTTTGAGGTTGGTTGGGGGAGGG - Intronic
985838963 5:2291405-2291427 GTGTGGGGATGTCAGGGGCCTGG - Intergenic
988601175 5:32640767-32640789 TTTTCAGGATGGCTGGTGGCTGG - Intergenic
988740447 5:34064116-34064138 GTGTGAGGCTGTCTGGGGAAGGG - Intronic
989204024 5:38793810-38793832 GTGTGAAGAGGTCTGGGGACAGG - Intergenic
990311371 5:54542191-54542213 GTTTGAGGATGTTTAGGGGTAGG - Intronic
990992381 5:61698799-61698821 CTTTGAGGATGGCTGGGTGCAGG + Intronic
992178455 5:74173646-74173668 GTTTGACGATGGCTGGAGTCAGG - Intergenic
992293587 5:75305114-75305136 GTGTGAGGCTGTCTGGGAGAGGG + Intergenic
992761917 5:79957983-79958005 GTTGGAGTAGGGCTGGGGGCTGG - Intergenic
997682876 5:135768494-135768516 GTTTCATAATGTCTGGGGGAGGG + Intergenic
998658361 5:144207053-144207075 GTTTGACCAAGTCTGGGAGCTGG - Exonic
998899915 5:146842326-146842348 TTTTGGGGATGTGTGGGGGTGGG - Intronic
999109978 5:149110733-149110755 GTTGAAAGATGTCAGGGGGCTGG + Intergenic
999283150 5:150378146-150378168 GTTTGAGGAATGCTGGGGGATGG + Intronic
1001049663 5:168404202-168404224 GTTGGAGCATATCTGAGGGCTGG - Intronic
1001381132 5:171307435-171307457 GCTGCAGGATGTCTGGGGTCTGG - Exonic
1001637753 5:173224520-173224542 ATTTAAGAATGTCTTGGGGCTGG + Intergenic
1001746649 5:174097438-174097460 GCTTGTGGATGTCTGGGGGGAGG + Intronic
1001773222 5:174311299-174311321 GTGTGAGGAGGCCCGGGGGCGGG + Intergenic
1002476364 5:179468798-179468820 GGATGGGGATGTCTGGGAGCAGG - Intergenic
1004598305 6:17122709-17122731 ATAAGAGGATGTCGGGGGGCGGG + Intronic
1004726433 6:18315599-18315621 GATTGAGGACTTCTGGGGGTTGG - Intergenic
1004942132 6:20569967-20569989 GTTGGAGGGTGTCTGGGACCTGG + Intronic
1007709287 6:43811571-43811593 CTTGGAGGCTGGCTGGGGGCTGG + Intergenic
1008882375 6:56394237-56394259 GTTCCAGGCAGTCTGGGGGCAGG - Intergenic
1009669770 6:66731847-66731869 TTTTGAGGCTGTCATGGGGCTGG + Intergenic
1009924003 6:70098115-70098137 GGTTGAGGATAGCTGGGGCCAGG - Intronic
1013543170 6:111131635-111131657 GTGTGAGGCTGTCTGGGGAAGGG + Intronic
1016007045 6:139099660-139099682 GTTCGTGTGTGTCTGGGGGCAGG + Intergenic
1017442847 6:154479893-154479915 GTGTGAGGGAGTCTGGGGGCTGG - Intronic
1018982310 6:168611092-168611114 CTGGGAGGATGTCAGGGGGCTGG - Intronic
1020278526 7:6638196-6638218 GTGTGGGCAGGTCTGGGGGCCGG + Intronic
1022482547 7:30753298-30753320 GTTTCAGGCTGACTGGGAGCTGG - Intronic
1022583025 7:31575672-31575694 GTTTGAGGAATTCTGGAGGGGGG + Intronic
1022968075 7:35492841-35492863 GCTTGAGGAGGTGAGGGGGCCGG + Intergenic
1023058485 7:36308348-36308370 GTGTGAGGATGACTGGGTGGAGG + Intergenic
1023633849 7:42189077-42189099 GGTTGTGGCTGTGTGGGGGCAGG + Intronic
1023864714 7:44233255-44233277 GTTTGAAGATGTCATGGGGGTGG + Intronic
1024644128 7:51357034-51357056 GATTTAGTATGCCTGGGGGCGGG - Intergenic
1024897664 7:54279211-54279233 GTGGGTGGATGTGTGGGGGCTGG + Intergenic
1032115789 7:129116101-129116123 ATTTGAGGATGTCCCAGGGCTGG + Intergenic
1033982944 7:147188235-147188257 GTTTGCAGATGTGTGTGGGCAGG + Intronic
1034535048 7:151721111-151721133 GATAGAGGATGTCAGAGGGCTGG + Intronic
1035691967 8:1565807-1565829 CTTTGGTGATGTCTTGGGGCTGG - Exonic
1035742512 8:1938973-1938995 GTTCGGGGGTCTCTGGGGGCTGG - Intronic
1035905265 8:3502975-3502997 GGTTGTGCATGTGTGGGGGCAGG + Intronic
1036411044 8:8501792-8501814 GTTTGTGTGTGTGTGGGGGCAGG - Intergenic
1036646019 8:10611759-10611781 GTGTGGGGAGGTATGGGGGCCGG + Exonic
1036768928 8:11565751-11565773 CTTTAAGGAGGTCTGGGGGGGGG + Intergenic
1037136639 8:15470530-15470552 GTTTGAGTATGTGTCGGGACAGG + Intronic
1037287463 8:17316845-17316867 ATTTGAGAATCTATGGGGGCTGG + Intronic
1037511616 8:19588937-19588959 GTTTGAAAATGTGTGGGGGTGGG + Intronic
1037752681 8:21692895-21692917 GCCTGAGGCTGGCTGGGGGCAGG - Exonic
1038274710 8:26111244-26111266 CTTTGAGGGTGTCTGGAGTCTGG - Intergenic
1041230754 8:55748698-55748720 GTTGGAGGATGACTGGAGCCTGG - Intronic
1042053888 8:64741612-64741634 GTTTAAGAATTTTTGGGGGCTGG - Intronic
1042055746 8:64763619-64763641 GTGTGAGGCTGTCTGGGGAAGGG + Intronic
1043844405 8:85148342-85148364 GTTTAAGGCTGGCTGGGGGCAGG + Intergenic
1047240542 8:123083809-123083831 CTTTGAGGATATCTGGTGGAGGG - Intronic
1047422950 8:124722275-124722297 GTTTAAGATTCTCTGGGGGCTGG - Intronic
1047791873 8:128211533-128211555 GTCTGTGGATGGCTGGGAGCAGG - Intergenic
1048136707 8:131753097-131753119 GTTTGAGGGAGACTGGGGGGAGG + Intergenic
1049457516 8:142701002-142701024 CTTTGAGGGAGTCGGGGGGCAGG + Intronic
1049805406 8:144536568-144536590 GTCTGAGGACGTCTGTGGCCAGG + Intronic
1052825522 9:33171283-33171305 AGTTGGGGCTGTCTGGGGGCTGG + Intergenic
1053477580 9:38393244-38393266 GTTTGTGGAAGTCTGGGGTGAGG + Intronic
1056704927 9:88943794-88943816 GTGTGAGGCTGTCTGGGGAAGGG - Intergenic
1058361550 9:104152862-104152884 GTTTGAGGACCTCTGGGGAGGGG - Intergenic
1058377486 9:104339963-104339985 GTTGGAGGATGTATGGGAGCTGG + Intergenic
1058961726 9:109998335-109998357 CTTTGAGGAAGTCTGGAGCCCGG - Intronic
1060779817 9:126403203-126403225 GTAAGAGGATGTGTGGGGGGCGG - Intronic
1061162250 9:128902140-128902162 GTTTGAGTGTGTCTGGGGAGTGG - Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1061537437 9:131258743-131258765 GTCTGAGGATGGGTGGGGACAGG - Exonic
1062589891 9:137269194-137269216 GTGAGAGGATGGCTGGGGACAGG - Intronic
1185589739 X:1267107-1267129 GTGTGAGGATGTGTGTGTGCAGG + Intergenic
1186415872 X:9382588-9382610 GTTTGAGCATCTCTGGGTGTTGG - Intergenic
1186522964 X:10221894-10221916 GCTTGTGGATGTTTGGGGGCCGG + Intronic
1186735553 X:12459483-12459505 GTTAGTGGATATCTGGGGCCAGG - Intronic
1186747408 X:12583808-12583830 GCTTGGGAATGGCTGGGGGCGGG + Intronic
1189271821 X:39757468-39757490 GATTTAGCAGGTCTGGGGGCAGG + Intergenic
1189373023 X:40445190-40445212 GTTTGATGAGCTCCGGGGGCTGG - Intergenic
1191867966 X:65720826-65720848 GCTTGAGGAAGTCTAGGGCCTGG + Intronic
1193286874 X:79724086-79724108 TTTTGAGGATGTCAGGGTGTTGG - Intergenic
1195372368 X:104189979-104190001 GATTCACTATGTCTGGGGGCGGG - Exonic
1195584696 X:106551919-106551941 GTGTGAGGCTGTCTGGGGAAGGG + Intergenic
1195698893 X:107687034-107687056 GTTGGAGGAAGCCTGGGAGCAGG - Intergenic
1199267278 X:145843380-145843402 GTGTGAGGCTGCCTGGGGGAGGG + Intergenic
1199339779 X:146663120-146663142 GAATGAGGATGTGTGGGGGGGGG - Intergenic
1200066832 X:153507993-153508015 GGTTGAGGACATGTGGGGGCGGG - Intronic
1200377956 X:155804062-155804084 GTCAGATGGTGTCTGGGGGCTGG + Intergenic