ID: 1180084022

View in Genome Browser
Species Human (GRCh38)
Location 21:45499493-45499515
Sequence CAGCCCACACAGGTTCCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180084022_1180084037 23 Left 1180084022 21:45499493-45499515 CCCTCAGGAACCTGTGTGGGCTG No data
Right 1180084037 21:45499539-45499561 GTGGGGTCAGAGGCTCCCTCGGG No data
1180084022_1180084030 4 Left 1180084022 21:45499493-45499515 CCCTCAGGAACCTGTGTGGGCTG No data
Right 1180084030 21:45499520-45499542 GCATGGCATCCCAGGAACAGTGG No data
1180084022_1180084031 5 Left 1180084022 21:45499493-45499515 CCCTCAGGAACCTGTGTGGGCTG No data
Right 1180084031 21:45499521-45499543 CATGGCATCCCAGGAACAGTGGG No data
1180084022_1180084036 22 Left 1180084022 21:45499493-45499515 CCCTCAGGAACCTGTGTGGGCTG No data
Right 1180084036 21:45499538-45499560 AGTGGGGTCAGAGGCTCCCTCGG No data
1180084022_1180084032 6 Left 1180084022 21:45499493-45499515 CCCTCAGGAACCTGTGTGGGCTG No data
Right 1180084032 21:45499522-45499544 ATGGCATCCCAGGAACAGTGGGG No data
1180084022_1180084026 -4 Left 1180084022 21:45499493-45499515 CCCTCAGGAACCTGTGTGGGCTG No data
Right 1180084026 21:45499512-45499534 GCTGCCCCGCATGGCATCCCAGG No data
1180084022_1180084034 13 Left 1180084022 21:45499493-45499515 CCCTCAGGAACCTGTGTGGGCTG No data
Right 1180084034 21:45499529-45499551 CCCAGGAACAGTGGGGTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180084022 Original CRISPR CAGCCCACACAGGTTCCTGA GGG (reversed) Intronic