ID: 1180084981

View in Genome Browser
Species Human (GRCh38)
Location 21:45504467-45504489
Sequence CCCGGGGGCGGCGGTTTCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 66}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180084967_1180084981 14 Left 1180084967 21:45504430-45504452 CCGAGGTGATGCAGGACAGAAAG 0: 1
1: 0
2: 1
3: 25
4: 263
Right 1180084981 21:45504467-45504489 CCCGGGGGCGGCGGTTTCTTCGG 0: 1
1: 0
2: 0
3: 9
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180084981 Original CRISPR CCCGGGGGCGGCGGTTTCTT CGG Exonic