ID: 1180085015

View in Genome Browser
Species Human (GRCh38)
Location 21:45504555-45504577
Sequence CAGTAAGTCCCAGCCTGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180085000_1180085015 15 Left 1180085000 21:45504517-45504539 CCCAGGCCCCCCAGGCCCACGTG 0: 1
1: 0
2: 4
3: 50
4: 648
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180085005_1180085015 7 Left 1180085005 21:45504525-45504547 CCCCAGGCCCACGTGGCTACCCT 0: 1
1: 0
2: 0
3: 22
4: 174
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084998_1180085015 17 Left 1180084998 21:45504515-45504537 CCCCCAGGCCCCCCAGGCCCACG 0: 1
1: 1
2: 6
3: 79
4: 655
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084996_1180085015 22 Left 1180084996 21:45504510-45504532 CCGGCCCCCCAGGCCCCCCAGGC 0: 1
1: 3
2: 10
3: 169
4: 1352
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084993_1180085015 24 Left 1180084993 21:45504508-45504530 CCCCGGCCCCCCAGGCCCCCCAG 0: 1
1: 1
2: 12
3: 149
4: 1115
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180085007_1180085015 5 Left 1180085007 21:45504527-45504549 CCAGGCCCACGTGGCTACCCTGG 0: 1
1: 0
2: 2
3: 33
4: 301
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084992_1180085015 25 Left 1180084992 21:45504507-45504529 CCCCCGGCCCCCCAGGCCCCCCA 0: 1
1: 0
2: 16
3: 156
4: 1247
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180085004_1180085015 8 Left 1180085004 21:45504524-45504546 CCCCCAGGCCCACGTGGCTACCC 0: 1
1: 0
2: 0
3: 35
4: 267
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084990_1180085015 27 Left 1180084990 21:45504505-45504527 CCCCCCCGGCCCCCCAGGCCCCC 0: 1
1: 2
2: 42
3: 356
4: 2528
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180085001_1180085015 14 Left 1180085001 21:45504518-45504540 CCAGGCCCCCCAGGCCCACGTGG 0: 1
1: 0
2: 4
3: 64
4: 555
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084991_1180085015 26 Left 1180084991 21:45504506-45504528 CCCCCCGGCCCCCCAGGCCCCCC 0: 2
1: 0
2: 24
3: 245
4: 2040
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084997_1180085015 18 Left 1180084997 21:45504514-45504536 CCCCCCAGGCCCCCCAGGCCCAC 0: 1
1: 2
2: 20
3: 144
4: 1117
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180085006_1180085015 6 Left 1180085006 21:45504526-45504548 CCCAGGCCCACGTGGCTACCCTG 0: 1
1: 0
2: 1
3: 17
4: 225
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084994_1180085015 23 Left 1180084994 21:45504509-45504531 CCCGGCCCCCCAGGCCCCCCAGG 0: 2
1: 6
2: 46
3: 200
4: 1246
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180084999_1180085015 16 Left 1180084999 21:45504516-45504538 CCCCAGGCCCCCCAGGCCCACGT 0: 1
1: 0
2: 5
3: 49
4: 464
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180085011_1180085015 -1 Left 1180085011 21:45504533-45504555 CCACGTGGCTACCCTGGGATTCC 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180085003_1180085015 9 Left 1180085003 21:45504523-45504545 CCCCCCAGGCCCACGTGGCTACC 0: 1
1: 0
2: 0
3: 22
4: 248
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1180085010_1180085015 0 Left 1180085010 21:45504532-45504554 CCCACGTGGCTACCCTGGGATTC 0: 1
1: 0
2: 1
3: 8
4: 101
Right 1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG 0: 1
1: 0
2: 0
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180085015 Original CRISPR CAGTAAGTCCCAGCCTGTGC AGG Exonic
901038870 1:6352275-6352297 CAGTGAGTCCCAGCCTCAGCTGG + Intronic
901934464 1:12618089-12618111 CGGCAACTCCCAGCCTCTGCTGG - Intergenic
903929480 1:26854112-26854134 CACCAAGTCCTTGCCTGTGCCGG + Exonic
905108450 1:35577543-35577565 CAGTGCCTCCCAGCCTGGGCGGG + Intronic
906784396 1:48601893-48601915 CAGAAAGCCCCAGTCTGAGCAGG + Intronic
911475475 1:98367488-98367510 CAGTACTTCCAAGCCTGTGGGGG + Intergenic
913181070 1:116322008-116322030 CAGTGTGTCCCTGCCTGCGCAGG + Intergenic
916194925 1:162213663-162213685 GAGTCATTCCCAGCCTGGGCAGG + Intronic
918730371 1:187985794-187985816 CTGTAAGTCTCAGCCTCTGAGGG + Intergenic
920920722 1:210295239-210295261 CAGGAAGTCCCCGGCTGGGCTGG + Intergenic
922115327 1:222607751-222607773 CACTCAGTGCCAGCCTGTGAAGG - Intergenic
923996902 1:239505848-239505870 CAGTAAGTTCCAGGCTGAGTTGG + Intronic
1068393824 10:56435169-56435191 CAGTGAGTCCCAGCATCTGAAGG - Intergenic
1071449344 10:85779568-85779590 CAGAAAAGCCCAGCCTGGGCCGG - Intronic
1073612100 10:104954642-104954664 CAGCAGGACCCAGCCTGAGCTGG + Intronic
1077302894 11:1855304-1855326 CAGGAAGGCCCAGGCTGGGCAGG + Intronic
1077419386 11:2443501-2443523 GAGTGGGTCCCAGCTTGTGCTGG - Intergenic
1080583862 11:33664832-33664854 CAGGAAGTCCTAGTCTGTTCTGG - Intronic
1081906618 11:46674371-46674393 CAGCTGGTCCCAGCCTGTCCCGG - Intronic
1083053003 11:59793523-59793545 CAGTGAGTCCCAGCGTGGGGAGG + Intronic
1083663927 11:64264688-64264710 CAGTAACTCCCAGATTGTTCTGG - Intronic
1083964662 11:66035994-66036016 CAGTCAGTCCCAGCCAGAGAAGG - Intergenic
1084067597 11:66714259-66714281 CAGTGACCCCCAGGCTGTGCTGG - Intronic
1084621566 11:70273952-70273974 CAGTTAGTCGCAGGCTGTGGAGG + Intronic
1087364681 11:97203083-97203105 AACTAACTCCCAGCCTGTGGGGG - Intergenic
1088666392 11:112098061-112098083 CAATCAGTCCCTCCCTGTGCTGG - Intronic
1088933092 11:114371977-114371999 CAGTAATTCCTGGCCTGTGGTGG + Intergenic
1089302299 11:117505916-117505938 CAGTGGGTCCCAGCCTGGGCGGG - Intronic
1089794011 11:120966007-120966029 AATAATGTCCCAGCCTGTGCTGG + Intronic
1091223319 11:133943673-133943695 CACCCAGTCCCTGCCTGTGCGGG - Intronic
1092002165 12:5041975-5041997 CAGTAAGTCCCAGGCTCCCCAGG + Intergenic
1092862265 12:12728786-12728808 CAGTGAGGCTCTGCCTGTGCAGG - Intronic
1093946930 12:25120093-25120115 CATAAGGTCCCAGCCTGAGCTGG - Intronic
1099663512 12:85596705-85596727 CTGTCAGTCCCAGCCTCTCCAGG - Intergenic
1102628604 12:114256808-114256830 CCGTAAGTCCCTTTCTGTGCTGG - Intergenic
1105661673 13:22502904-22502926 CAGCAAGACGCAGCCTGAGCTGG + Intergenic
1106420932 13:29585591-29585613 CAGTGAGTACCAGTGTGTGCGGG + Intronic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1107820153 13:44278378-44278400 CAGGAAGTCACATCCTGTGCAGG - Intergenic
1108450975 13:50562513-50562535 CAGTGAGCCCCAGCCTCTGAGGG - Intronic
1110519755 13:76461601-76461623 CAGTTAGTCCTAACATGTGCCGG - Intergenic
1113612903 13:111660439-111660461 CAGGGAGTCCCAGCCTGCCCTGG - Intronic
1113896504 13:113768108-113768130 CAGCAACTCCAAGGCTGTGCCGG + Intronic
1114319664 14:21536800-21536822 CCCTAAGTCCAAGCCTGTGTGGG - Intronic
1116113992 14:40624955-40624977 AAGTCAGACTCAGCCTGTGCCGG - Intergenic
1116165847 14:41333044-41333066 CAGTAAGTTCCAGGCTGAGTTGG - Intergenic
1118603836 14:67488755-67488777 CAGTAACCCGCAGGCTGTGCCGG - Intronic
1118985831 14:70753895-70753917 CAGCAACTCCATGCCTGTGCTGG + Intronic
1121334065 14:93066234-93066256 CAGCAAGTCCCAGCCTCAGGAGG + Intronic
1122407764 14:101510348-101510370 CAGTGAGTCCCAGCTTATACAGG - Intergenic
1125771793 15:42172654-42172676 CAGGATGGCCCAGCCTGTCCTGG + Intronic
1128674734 15:69600231-69600253 CAGTGAACCCCAGCCTGTGCTGG + Intergenic
1128777002 15:70328209-70328231 CACTTAGTCCCTGCCTGTCCAGG + Intergenic
1129893186 15:79085386-79085408 CAGTAAGATCCACCCTTTGCTGG - Intronic
1132516906 16:370247-370269 CAGTCAGTCGCAGCCTGGCCAGG + Intronic
1132543148 16:520843-520865 CAGGAAGGTCCAGCCTGAGCTGG + Exonic
1132881888 16:2165956-2165978 CGGTTATTCCCAGCCTGGGCTGG - Intronic
1135370575 16:21895654-21895676 CAGGAAGTTGCAGACTGTGCAGG + Intergenic
1136314460 16:29443550-29443572 CAGGAAGTTGCAGACTGTGCAGG + Exonic
1136327899 16:29545312-29545334 CAGGAAGTTGCAGACTGTGCAGG + Intergenic
1136442587 16:30285319-30285341 CAGGAAGTTGCAGACTGTGCAGG + Intergenic
1141669112 16:85482241-85482263 CAGTGAGTCCCAGCATGTTCTGG - Intergenic
1141690796 16:85595137-85595159 AGGAATGTCCCAGCCTGTGCGGG - Intergenic
1142177352 16:88651228-88651250 CAGGAACTCCCCGCCTGGGCTGG - Intergenic
1144726811 17:17506363-17506385 CAGGAAGGGCCAGCCTGGGCAGG - Intronic
1148951128 17:51313578-51313600 CAGAAAGTCCCAGCATGTCATGG + Intergenic
1149980487 17:61307173-61307195 CAGCAAGTCCCAACTTGGGCCGG - Intronic
1151135741 17:71944453-71944475 CAGTAAGTTCCAGGCTGAGGTGG + Intergenic
1151680718 17:75621336-75621358 CAGTCTGGCCCAGCCTGTGGGGG - Intergenic
1152072717 17:78141954-78141976 CACTAAGGCCCAGGCGGTGCGGG - Exonic
1152137314 17:78512106-78512128 CATTAAGTCCCAGCCAGCCCAGG - Intronic
1152556228 17:81054502-81054524 CAGCACGCCCCTGCCTGTGCGGG + Intronic
1160462330 18:79048556-79048578 CATTAAATCCCAGCCGGTGCTGG + Intergenic
1160478673 18:79218231-79218253 CAGGAGCTGCCAGCCTGTGCCGG - Intronic
1160478708 18:79218494-79218516 CAGGAGCTGCCAGCCTGTGCCGG - Intronic
1160720430 19:594750-594772 CAGGAAGGCCCAGCGTGTGCAGG + Intronic
1161431137 19:4233107-4233129 CAGCGAGCCCCACCCTGTGCAGG + Exonic
1161768127 19:6217844-6217866 CTGCAGGGCCCAGCCTGTGCAGG + Intronic
1162958667 19:14113673-14113695 CAGGAATGCCCAGCCTGGGCTGG + Intronic
1164751884 19:30662318-30662340 CATTAAGTCCCAGCTTGTGTTGG + Intronic
1165108418 19:33487650-33487672 CAGTCAGCCCCAGCCTGGCCTGG + Intronic
1165396051 19:35564034-35564056 CATTATGTCCTAGCCTGTGATGG - Intergenic
1168189281 19:54726241-54726263 CTGTAGGTCCCTGCATGTGCTGG - Exonic
1168197518 19:54786651-54786673 CTGTAGGTCCCTGCATGTGCTGG - Intronic
1168199556 19:54804981-54805003 CTGTAGGTCCCTGCGTGTGCTGG - Exonic
1168206177 19:54852186-54852208 CTGTAGGTCCCTGCATGTGCTGG - Exonic
1168231319 19:55033829-55033851 CAGGACGTCTCAGCATGTGCTGG + Intronic
925386782 2:3467564-3467586 CAGTAAGTTCCGGCTTGGGCAGG + Intronic
926242703 2:11100805-11100827 CATTTGGTGCCAGCCTGTGCTGG + Intergenic
927026468 2:19073660-19073682 CAGCAGGACCCAGCCTGGGCTGG + Intergenic
928270961 2:29854107-29854129 GAGAAAGACCCATCCTGTGCAGG - Intronic
928283662 2:29970555-29970577 CAGTCAGTCTCAGCTTATGCTGG - Intergenic
929757973 2:44783804-44783826 CAGTGAGTCACAGTCTTTGCTGG - Intergenic
931022605 2:58066111-58066133 CTGTAAGTCCTAGCCAGCGCAGG - Intronic
931554016 2:63479795-63479817 CTGGAAGTCCCAGCCAGAGCTGG + Intronic
932809656 2:74813915-74813937 CAATAAGACGCAGCCTCTGCTGG - Intergenic
933318000 2:80737725-80737747 CAGTAAGACCCCCCTTGTGCAGG - Intergenic
937463424 2:122109303-122109325 CAGCCAGTGCCTGCCTGTGCTGG + Intergenic
938371175 2:130769077-130769099 CAGTCTCTCCCTGCCTGTGCTGG - Intergenic
940458342 2:153930693-153930715 CAGTAAGTACCATGCTGTGTTGG + Intronic
941008431 2:160270616-160270638 CAGTGCCTCCCAGCCTGAGCCGG - Intronic
941023193 2:160431847-160431869 CAGGAAGACCCAGCCTATTCTGG - Intronic
946108338 2:217391628-217391650 CAATAAGGCCCAGCCTGAGGTGG - Intronic
946157757 2:217818198-217818220 CGGGGAGTCCCAGCCTGGGCCGG - Exonic
946225275 2:218261171-218261193 CAGGAAGGCCCAGGCTGGGCAGG + Exonic
947581105 2:231319202-231319224 CAGTAAGTCACTGACTGGGCTGG + Intronic
947984617 2:234437734-234437756 CACTGAGTACCACCCTGTGCAGG - Intergenic
1168898131 20:1338034-1338056 CAGGAAGACCCAGCCTGACCTGG + Intronic
1169612500 20:7397762-7397784 CAGTATGTCTCAGTCTGTTCTGG - Intergenic
1170573088 20:17643354-17643376 TAGGAAGTCCCAGCCTGGGGTGG + Intronic
1172972494 20:38883578-38883600 CAGTAGGGCCCTGCCTGTGTAGG + Intronic
1173079124 20:39849375-39849397 CAGTAAGACACAGCAGGTGCAGG - Intergenic
1173285739 20:41670211-41670233 GAGGAAGTCCCAGGCTATGCTGG + Intergenic
1173726808 20:45304137-45304159 CAGTAAATCCCATCCCGTGGGGG - Intronic
1173997043 20:47346385-47346407 CAGCATGACCCAGCCTGTGCTGG - Intronic
1175309356 20:58000858-58000880 CAGTAAGTCACATACTGTCCAGG + Intergenic
1180085015 21:45504555-45504577 CAGTAAGTCCCAGCCTGTGCAGG + Exonic
1180681316 22:17628832-17628854 CAGGAAGTCCCGCCCTGTCCCGG + Intergenic
1181016218 22:20070378-20070400 CAGTCAGTCCCAGGCTGTGTGGG + Intergenic
1181166248 22:20984780-20984802 CCGTCATGCCCAGCCTGTGCTGG - Intronic
1181726185 22:24812573-24812595 CCATTAGTCCCAGCTTGTGCAGG + Intronic
1181832238 22:25569984-25570006 CAGCAAGACCCTGCCTGGGCGGG - Intronic
1182067437 22:27440806-27440828 CAGTAAGTCAGTGACTGTGCTGG - Intergenic
1183606404 22:38868979-38869001 CAGGAGGCCCCAGCCTGGGCTGG - Intronic
1185065067 22:48628028-48628050 CAGCAGGTCCCAGCCTGACCAGG - Intronic
950121647 3:10485777-10485799 CAGGAAGCCCCAACCTGAGCCGG - Intronic
950259383 3:11533019-11533041 AAGCAAGCCCCAGCCTGAGCGGG + Intronic
952959403 3:38580181-38580203 CAGCCAGGCCCAGCCAGTGCAGG + Intronic
952990640 3:38828207-38828229 CAGTAAGTCCATGCCAGGGCAGG + Intergenic
953928910 3:46996391-46996413 CAGTCAGTCCCAGCCTCCACAGG + Exonic
955827431 3:62963126-62963148 CAAAAAGCCCCAGCCTGTGGGGG - Intergenic
956868313 3:73391068-73391090 CAGTGAGGCCCAGCTTGTCCTGG + Exonic
958104678 3:89056566-89056588 ATGTAAGTCCCAGCCTGAGTGGG - Intergenic
959255287 3:104003137-104003159 CAGTTATTCCCAGGCTTTGCTGG + Intergenic
961000097 3:123368233-123368255 TTGTTAGTCCCAGCCTGTGTTGG - Intronic
962373529 3:134840859-134840881 CACTAAATCCCACCCTGTGCTGG - Intronic
963893086 3:150657807-150657829 AAGTAAGTCCCAGGAAGTGCAGG + Intergenic
968490504 4:888433-888455 AGGTGAGTCCCAGCCTGTGGTGG - Intronic
968891795 4:3373299-3373321 CAGAGAGTCCCAGCCCCTGCGGG + Intronic
970026195 4:11626520-11626542 CGGTGAGTCCCAGACTGGGCTGG - Intergenic
982816153 4:159887428-159887450 CAGGCAATCCAAGCCTGTGCTGG + Intergenic
984302787 4:177944752-177944774 CAGTAAATCCCAACCTATACGGG - Intronic
986074255 5:4318323-4318345 CAGTAAGTACAATCCTGTGTTGG - Intergenic
986276188 5:6277121-6277143 CAGTAATTCCCATCCCGTGATGG + Intergenic
990701628 5:58480901-58480923 CAGGGAGTGCCAGCATGTGCAGG + Intergenic
991246332 5:64512076-64512098 CAGTAACTCCCAAGGTGTGCTGG - Intronic
995307726 5:110673612-110673634 CAGCAGCTCCCAGCCTGTGTGGG + Intronic
995393789 5:111666544-111666566 CTATGAGTCCCAGCCTCTGCAGG + Intronic
995716439 5:115085716-115085738 CAGGAAGACTCATCCTGTGCTGG + Intergenic
999012337 5:148056452-148056474 CACTCAGTGCCAGCCTGTGAAGG + Intronic
999268812 5:150284531-150284553 CAGTGTGTCTCAGCCTGTGTGGG + Intronic
999554333 5:152723636-152723658 CAGTGAGTCCAAGCCTTTTCAGG + Intergenic
1003618542 6:7676627-7676649 CAGTAATATCCTGCCTGTGCTGG - Intergenic
1004431135 6:15544563-15544585 TAGTAAGTCCCAGCAAATGCTGG - Intronic
1006803599 6:36774796-36774818 CACCAAGCCCCAGCCTGTGCAGG + Intronic
1007399753 6:41597084-41597106 CACTAAGTAACGGCCTGTGCTGG - Intronic
1008292987 6:49740798-49740820 CTGTAAGACCCATCCTGTGTGGG + Intronic
1009729358 6:67579536-67579558 CACTCAGTGCCAGCCTGTACTGG + Intergenic
1014691595 6:124569973-124569995 CAGTAAGTTCCAGGCTGAGGTGG + Intronic
1019373912 7:678644-678666 CAGGAAGTCCCTGTCTGTCCAGG + Intronic
1019724637 7:2594679-2594701 CAGGAAGTCCCGGCCTGCGATGG + Intronic
1020869349 7:13607935-13607957 CAGTCAATGCCAGCCTGTGAAGG + Intergenic
1022472661 7:30691269-30691291 CAGTGAATCCCAGCCTCTGGAGG + Intronic
1032190450 7:129762524-129762546 CCGTAGGACCCAGCCAGTGCGGG + Intergenic
1034843035 7:154417461-154417483 CCGTAAGCCCCAGCCTGTGAAGG + Intronic
1034903356 7:154921916-154921938 CAATGGGTCCCAGGCTGTGCTGG - Intergenic
1035020830 7:155799188-155799210 GAGTAAATACCAGGCTGTGCGGG + Intergenic
1039577307 8:38633818-38633840 CAGGAAGTCCCAGCATATTCTGG - Intergenic
1039835053 8:41249479-41249501 CAGTAAGTCCCAGGCCCTGAAGG + Intergenic
1047545133 8:125809127-125809149 CACTAAGACCCAGCCTATACTGG - Intergenic
1048505573 8:135017970-135017992 CTGTAAGTACTAGCCTTTGCAGG - Intergenic
1048989074 8:139750765-139750787 CAACAGGTCCCAGCCTATGCTGG + Intronic
1049365734 8:142236004-142236026 CAATTAGCCCCAGGCTGTGCAGG + Intronic
1049608198 8:143539459-143539481 CAGTGAGTCCCAGGCTCTGGGGG - Intronic
1052074008 9:24118310-24118332 CAGGAAGTCCCAGTGAGTGCTGG + Intergenic
1058928199 9:109689715-109689737 CTGTAAATCCCAGCCTGGGGAGG + Intronic
1061301838 9:129709982-129710004 CAGTAAGTCCCAGCCCCTACTGG + Intronic
1061801766 9:133116672-133116694 CAGGAAGTGCCCGCATGTGCTGG - Intronic
1062044106 9:134417326-134417348 CGGTGAGTTGCAGCCTGTGCAGG + Exonic
1062309659 9:135929038-135929060 GAATGAGTCCCAGCCTGTGTAGG - Intergenic
1062397288 9:136357605-136357627 GGGTCAGTCCCAGGCTGTGCTGG + Intronic
1062503352 9:136860682-136860704 CAGCCTGTCCCAGCCTGGGCGGG - Exonic
1062592493 9:137280583-137280605 CAGTAAGCCCAAGCCAGGGCTGG - Exonic
1186734367 X:12445909-12445931 CACAAAGACCAAGCCTGTGCAGG + Intronic
1189167041 X:38870555-38870577 GAGTCAGTCACAGGCTGTGCAGG - Intergenic
1191723081 X:64251047-64251069 CAGGCAATCCCAGCCTTTGCAGG + Intergenic
1192261030 X:69505884-69505906 CAGCAAGTCCCAGACCGTGTAGG - Exonic
1200152143 X:153956473-153956495 CAGAGTGCCCCAGCCTGTGCAGG - Intronic
1201368829 Y:13238157-13238179 CAGGAAAACCCAGCCTGAGCAGG + Intergenic