ID: 1180085243

View in Genome Browser
Species Human (GRCh38)
Location 21:45505301-45505323
Sequence CACACGAGGCGGCCTCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180085243_1180085247 -3 Left 1180085243 21:45505301-45505323 CCGGGCAGAGGCCGCCTCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1180085247 21:45505321-45505343 GTGGCTTCGTGTTCCCACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 125
1180085243_1180085252 27 Left 1180085243 21:45505301-45505323 CCGGGCAGAGGCCGCCTCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1180085252 21:45505351-45505373 CCTGCAGCTATCAGCGTTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180085243 Original CRISPR CACACGAGGCGGCCTCTGCC CGG (reversed) Intronic
900500330 1:3001406-3001428 CACTCTAGGCTGCCTCCGCCTGG + Intergenic
903191020 1:21656034-21656056 CACAAGAGGCTGCCTGGGCCAGG - Intronic
903502406 1:23808385-23808407 CAGAAGAGGGGGCCTTTGCCTGG + Intronic
905943584 1:41883662-41883684 CCCACCAGGCTGCCTCTGACAGG - Intronic
906473564 1:46151416-46151438 CAAAAGAGGAGGCCTCTGCCAGG - Intronic
907107715 1:51899298-51899320 CACACACGGTGGCCTCTGCCAGG + Intergenic
912812549 1:112804898-112804920 CACACCGGTCGGCTTCTGCCAGG - Intergenic
916369481 1:164074191-164074213 CATACCAGGCTGCCACTGCCTGG + Intergenic
918238907 1:182604563-182604585 CACACGCGGCGTCCTCTGGGCGG - Intergenic
920036146 1:203067129-203067151 CACTGGTGGCTGCCTCTGCCTGG - Intronic
920255187 1:204649851-204649873 CACGCCAGGTTGCCTCTGCCTGG - Intronic
921384676 1:214556637-214556659 CACAGGAGGCTGCCTCTGGCGGG + Intergenic
922222918 1:223622133-223622155 CACACTAACCTGCCTCTGCCAGG + Intronic
922674585 1:227542625-227542647 CCCTCGCCGCGGCCTCTGCCAGG - Intergenic
924435475 1:244036626-244036648 GTCACGAGGCCGCCTCGGCCTGG - Intergenic
1069501440 10:68956478-68956500 CAAACGACGCGTCCACTGCCCGG - Intronic
1070539849 10:77408160-77408182 CTCAGGAGGCAGCCTCTCCCTGG - Intronic
1075000703 10:118795125-118795147 CACTCCAGGCAGCCCCTGCCCGG + Intergenic
1075407620 10:122205037-122205059 CTCACGAGGCGGACTCTGCTGGG + Intronic
1076831142 10:132994938-132994960 CTCAGGAGGAGGCCACTGCCGGG - Intergenic
1082179670 11:49102555-49102577 CACACGGAGCGGCCTAAGCCGGG + Intergenic
1084893298 11:72247765-72247787 CTCACGAGTCAACCTCTGCCTGG + Intergenic
1085013540 11:73157768-73157790 CAGAAGAGGTGGCCTCGGCCCGG + Intergenic
1089597630 11:119591279-119591301 CAGAAGAGGGAGCCTCTGCCAGG + Intergenic
1090076833 11:123584942-123584964 GACAGGCGGTGGCCTCTGCCAGG - Intronic
1091609124 12:1988266-1988288 CTCACAAAGCAGCCTCTGCCTGG + Intronic
1092262625 12:6960595-6960617 CACACGTGTGGGCCTCTGCTAGG + Intronic
1095232222 12:39752710-39752732 CACACGATGTTGTCTCTGCCTGG - Intronic
1095271484 12:40224722-40224744 CCCAGGAGGCGGCGTCCGCCCGG + Intronic
1104450561 12:128865122-128865144 CACACGCCGAGGCTTCTGCCAGG + Intronic
1106350103 13:28921880-28921902 CACACCATGCAGCCACTGCCAGG + Intronic
1106554177 13:30796068-30796090 CACATGACACGGCCACTGCCAGG - Intergenic
1108531183 13:51328744-51328766 GACAGGAGGCTGCCTCTGGCAGG + Intergenic
1113842218 13:113366554-113366576 CACACCAGGGGGCCTCTGTGGGG + Intergenic
1114871716 14:26666490-26666512 CACATGAGACGACCTCAGCCTGG + Intergenic
1119402622 14:74374050-74374072 CACTCGATGTGGCCTCTTCCTGG - Intergenic
1121937201 14:98030777-98030799 CACACGTGGAGAACTCTGCCTGG - Intergenic
1124159420 15:27255111-27255133 CACAGGAGGCAGCCGCTGTCAGG - Intronic
1124340327 15:28886075-28886097 CACGCAGGGCCGCCTCTGCCGGG - Exonic
1128418529 15:67469367-67469389 CACATGAGGCTGCCTGGGCCAGG - Intronic
1128704451 15:69828425-69828447 CACACTACAGGGCCTCTGCCAGG - Intergenic
1130063433 15:80585750-80585772 CACAGGAGGCAGCCTCTGGGTGG + Intronic
1132091481 15:98951083-98951105 CACACGAAGTGTCCACTGCCTGG - Intronic
1132315049 15:100883565-100883587 CACAGGAGGCAGACTCTGGCTGG - Intronic
1132593185 16:735386-735408 CACACGCGGGTGCCTCTGCTGGG - Intronic
1132641534 16:980678-980700 CCCGCGAGGTGGCCTCGGCCCGG - Intronic
1133069243 16:3234939-3234961 CCCCAGAGGCGGCCTCAGCCTGG + Exonic
1133285151 16:4687212-4687234 CCCAAGAGGCGCCCTCTACCAGG + Intronic
1133339757 16:5028594-5028616 CACATGTGGTGCCCTCTGCCCGG + Intronic
1134063309 16:11211701-11211723 CAAAGGAGGCAGCCTCTGCTCGG - Intergenic
1136617679 16:31408609-31408631 CACGCGTGGGGGCCTCTCCCTGG - Intronic
1142227253 16:88883635-88883657 CAGAAGAGTCGGCCACTGCCGGG - Intronic
1142824383 17:2498954-2498976 CACATGCTGCTGCCTCTGCCTGG + Intronic
1145280200 17:21462491-21462513 CACAGGAGGAGGCCTCTTCAGGG + Intergenic
1145397685 17:22507983-22508005 CACAGGAGGTGGCCTCTTCAGGG - Intergenic
1146242688 17:31244662-31244684 CACACCACGGGGCCACTGCCAGG + Intronic
1147819658 17:43234243-43234265 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147821774 17:43246130-43246152 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147822866 17:43252285-43252307 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147825384 17:43267089-43267111 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147826507 17:43273556-43273578 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147827396 17:43278434-43278456 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147828504 17:43284595-43284617 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147829613 17:43290747-43290769 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1147831390 17:43300497-43300519 CCCCCGGGGCCGCCTCTGCCTGG + Intergenic
1151418238 17:73980796-73980818 TACACAATGCTGCCTCTGCCCGG - Intergenic
1151477198 17:74350832-74350854 CACCCGAGGTGGCCGCAGCCCGG + Exonic
1152681265 17:81669484-81669506 CACAGGAGGCGGACAGTGCCAGG - Intronic
1153772343 18:8426030-8426052 CCCCCGAGGAGGCCTCTTCCTGG - Intergenic
1158544261 18:58382271-58382293 CCCTGGAGGTGGCCTCTGCCAGG + Intronic
1161340460 19:3739051-3739073 CGCACGAGGAGGCCACTGGCTGG + Exonic
1161605233 19:5211140-5211162 CACATGTGGCACCCTCTGCCAGG + Intronic
1162515111 19:11142901-11142923 CCCATCAGGCGGCCTGTGCCGGG - Intronic
1163458196 19:17420967-17420989 CACACGCCGCTTCCTCTGCCTGG + Intronic
1163803971 19:19385317-19385339 CACCGGAGGCGGCCTTGGCCAGG - Intergenic
1164438330 19:28251719-28251741 CACAGGTGGCTGCCTCTCCCTGG - Intergenic
1164992022 19:32691764-32691786 CACTCGAGGCGGTCCCTGCTCGG + Intergenic
1166367417 19:42284526-42284548 CCCACGCGGGGGTCTCTGCCGGG - Intronic
925817670 2:7769111-7769133 CACACGCGGTGGACTGTGCCTGG - Intergenic
926087956 2:10032041-10032063 CACCCGAGGGGGCCTCACCCAGG + Intergenic
932674913 2:73771297-73771319 CACAAGAGGCTGCCTCTCCATGG + Intronic
935467148 2:103411814-103411836 CAGACAAGGCAGCATCTGCCAGG + Intergenic
935754264 2:106264946-106264968 CACAGGAGGCTGCCCCTGTCAGG + Intergenic
936057906 2:109275222-109275244 CTCACGTGGCAGCCTCTGCGGGG - Intronic
937669560 2:124523791-124523813 AACAGGAGGCTGCCTCTGCCTGG + Intronic
938959346 2:136327223-136327245 CAGATGCGGAGGCCTCTGCCAGG + Intergenic
947587359 2:231364859-231364881 CTCACGGGGTGGGCTCTGCCAGG - Intronic
948414703 2:237794560-237794582 CAGTTGAGGGGGCCTCTGCCAGG + Intronic
948718584 2:239882048-239882070 CACACGAGGCTCCCTCAGGCTGG + Intergenic
1168917416 20:1501449-1501471 CACACCATGCTGCCACTGCCAGG + Intergenic
1171333575 20:24362405-24362427 CACACCAAGAGGACTCTGCCTGG + Intergenic
1175984963 20:62760141-62760163 CACACTGGCCTGCCTCTGCCCGG + Exonic
1179010585 21:37553042-37553064 CCCTCGAGGCGGCCTGGGCCTGG + Intergenic
1179823780 21:43952496-43952518 GGCACGAGGCTGCCTCTGCCTGG - Intronic
1180085243 21:45505301-45505323 CACACGAGGCGGCCTCTGCCCGG - Intronic
1184034008 22:41910133-41910155 CCCGCGGGGCGGCCTCTGCGGGG + Exonic
1184738407 22:46412449-46412471 GACACCAGGAGGCCACTGCCCGG + Intronic
1185041673 22:48507457-48507479 CAGACGTGGTGGCGTCTGCCTGG + Intronic
1185218452 22:49616844-49616866 CACCCGACGCTGTCTCTGCCTGG - Intronic
1185333517 22:50261805-50261827 AACCCGAGGCGGCCGCCGCCGGG + Exonic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
949987847 3:9553768-9553790 CCCAGGCGGCGGCCTCTGCGCGG + Exonic
953020005 3:39107302-39107324 CCCGCGAGGCCGCCTCTCCCAGG + Intronic
954116474 3:48469450-48469472 CACACCATGCCGCCTCAGCCAGG - Exonic
954370250 3:50166395-50166417 CACTCCAGGGGGCCTCTCCCAGG + Intronic
955221479 3:57026757-57026779 CACACCAGGTGGCCTCTGATGGG - Intronic
961449887 3:126997928-126997950 CTCACAAGGCTGCCCCTGCCAGG - Intronic
961539586 3:127590524-127590546 CAGACCAGGCGGCCTGGGCCGGG + Exonic
961739821 3:129026255-129026277 CACCCCAGGCAGCCTGTGCCAGG + Intronic
962483205 3:135815768-135815790 TACACCAGGCGGCTGCTGCCAGG - Intergenic
962865803 3:139447300-139447322 CACAGGAGGCGGCCCCTGACAGG - Intergenic
967108365 3:186271794-186271816 CACATGAGGCTTCCTCTGCCTGG + Intronic
967791564 3:193554985-193555007 CCCACGAGTCGCCCTCTGCTAGG + Exonic
968481323 4:834406-834428 CACACGGGGCCCCCTCTGCTTGG + Intergenic
968515673 4:1014722-1014744 CACACGGGCCAGCCACTGCCCGG - Intronic
968914913 4:3493204-3493226 CACACCACGCAGCCTTTGCCTGG + Exonic
970511437 4:16785544-16785566 CACCCGATGCGGCTGCTGCCCGG - Intronic
975592130 4:76011122-76011144 CACACGCAGCGACCTCAGCCGGG + Intergenic
976016300 4:80559624-80559646 CACACAATGCAGCTTCTGCCAGG - Intronic
978576721 4:110196790-110196812 CCCAGGAGGCGGGCTCCGCCCGG + Intronic
985563237 5:602416-602438 CGCAGGAGACGGCCGCTGCCAGG - Intergenic
986345052 5:6827006-6827028 CTCAAGAGGCAGCCTCAGCCGGG - Intergenic
997429438 5:133827272-133827294 CACACCTGGCTGCCTCTGACAGG + Intergenic
998200322 5:140113710-140113732 GACCCTAGGCGGCCTCGGCCTGG - Intronic
998945857 5:147338664-147338686 CACATGAGGCCACCTCAGCCTGG - Intronic
999262587 5:150246907-150246929 CACCCGAGGGGCCCTCTGACTGG - Intronic
1000142954 5:158424356-158424378 CCCACAAGGCTGCATCTGCCTGG - Intergenic
1001057067 5:168458423-168458445 CACAAAAGGCGTCCTCTGCTGGG + Intronic
1004473761 6:15952097-15952119 CAAACCAGGAGGCCTCAGCCAGG - Intergenic
1004683427 6:17918687-17918709 CACAAGAAGCTCCCTCTGCCTGG + Intronic
1011340886 6:86313171-86313193 CACACCATGCAGCCTCTGCCAGG - Intergenic
1012401968 6:98848434-98848456 ACCAGGAAGCGGCCTCTGCCGGG + Intergenic
1012423900 6:99093821-99093843 CACAGCAGGCTGCATCTGCCAGG - Intergenic
1015156182 6:130098835-130098857 CACACGAGGCAGGCTCTATCAGG - Intronic
1018157158 6:160996137-160996159 CACAGGAGGCTGACTTTGCCAGG - Intronic
1023909643 7:44544262-44544284 CACCTGGGGCAGCCTCTGCCAGG - Intergenic
1032206000 7:129866048-129866070 CACCTGAGGCAGCCTGTGCCCGG + Intronic
1032740088 7:134730045-134730067 GACATGAGGCGGCTGCTGCCTGG + Intergenic
1034221406 7:149449286-149449308 CACACAAGGAGGCCTCTGTGAGG + Intronic
1034536668 7:151729676-151729698 CACAGGAGCCGGTCTCTGGCAGG - Intronic
1035162779 7:156963201-156963223 CACAGGGGGGTGCCTCTGCCTGG - Intronic
1035592342 8:825406-825428 CACAGAAGCTGGCCTCTGCCCGG + Intergenic
1036621054 8:10424723-10424745 CCCAGGAGGGGGCCTCTCCCTGG - Intronic
1038583456 8:28769834-28769856 CACACGTGGCAGCCTTTCCCTGG - Intronic
1039970177 8:42315497-42315519 CACAGGAGGCAGGCTCTGCAGGG + Intronic
1048118666 8:131554771-131554793 CACGCCAGGAGGCCACTGCCAGG - Intergenic
1048439962 8:134452618-134452640 CAAACAAGGCTGCTTCTGCCAGG + Intergenic
1049265900 8:141667781-141667803 CACACGTGGCTCCTTCTGCCCGG - Intergenic
1049693721 8:143973638-143973660 CAGACGCGGCTCCCTCTGCCCGG - Intronic
1053003714 9:34591263-34591285 CACACAAGGTGTCCTCTCCCCGG + Intergenic
1053447737 9:38165926-38165948 CCCATGAGGCTGGCTCTGCCTGG + Intergenic
1056818285 9:89817508-89817530 CACAGGAGGTGGGGTCTGCCAGG + Intergenic
1057273796 9:93665599-93665621 CTCCCGAGGGGTCCTCTGCCAGG - Intronic
1057546044 9:96021161-96021183 CAGGCGAAGCCGCCTCTGCCCGG - Intergenic
1058226647 9:102372147-102372169 CGCACCAGGCTGCCACTGCCCGG + Intergenic
1058286490 9:103186776-103186798 CTCTCGAGGCCTCCTCTGCCTGG + Intergenic
1060115458 9:120936683-120936705 CACTCGGAGCGCCCTCTGCCGGG + Intergenic
1060508740 9:124216988-124217010 CACAACAGTTGGCCTCTGCCAGG + Intergenic
1061945238 9:133905036-133905058 CACACGTGGAGGCTTCTCCCAGG + Intronic
1062095915 9:134703305-134703327 CACAGGAGCCGTCCTCAGCCAGG + Intronic
1185658085 X:1702192-1702214 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658092 X:1702235-1702257 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658126 X:1702449-1702471 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658133 X:1702492-1702514 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658183 X:1702792-1702814 CAGCGGAGGTGGCCTCTGCCAGG + Intergenic
1185658190 X:1702834-1702856 CAGCGGAGGTGGCCTCTGCCTGG + Intergenic
1186110109 X:6246596-6246618 CACAAGAGGCTTCCTCTCCCAGG + Intergenic
1190688628 X:52895718-52895740 TTCACGAGGCGGCTTCTTCCAGG + Intronic
1190697355 X:52960074-52960096 TTCACGAGGCGGCTTCTTCCAGG - Intronic
1193856834 X:86612652-86612674 CACACCAGGTGGCTGCTGCCAGG + Intronic
1194253071 X:91602287-91602309 CACACCAGGCTGCCACTGCTGGG - Intergenic
1194823299 X:98531502-98531524 CACACCAGGCCGCCAGTGCCAGG - Intergenic
1200572007 Y:4843531-4843553 CACACCAGGCTGCCGCTGCTGGG - Intergenic
1201486157 Y:14496551-14496573 CACAAGAGGCTGCCTGTCCCAGG - Intergenic