ID: 1180093586

View in Genome Browser
Species Human (GRCh38)
Location 21:45544202-45544224
Sequence TGCCACGCAGGGGGACCCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180093586_1180093602 25 Left 1180093586 21:45544202-45544224 CCCTCGGGTCCCCCTGCGTGGCA 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1180093602 21:45544250-45544272 ACAAGGCCCAGGTTTCCTGCAGG 0: 1
1: 0
2: 2
3: 36
4: 186
1180093586_1180093597 14 Left 1180093586 21:45544202-45544224 CCCTCGGGTCCCCCTGCGTGGCA 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1180093597 21:45544239-45544261 TCCCCAGCCACACAAGGCCCAGG 0: 1
1: 0
2: 2
3: 37
4: 385
1180093586_1180093596 8 Left 1180093586 21:45544202-45544224 CCCTCGGGTCCCCCTGCGTGGCA 0: 1
1: 0
2: 0
3: 3
4: 94
Right 1180093596 21:45544233-45544255 GGGAGTTCCCCAGCCACACAAGG 0: 1
1: 0
2: 0
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180093586 Original CRISPR TGCCACGCAGGGGGACCCGA GGG (reversed) Intronic
900270928 1:1788274-1788296 TTCCTCCCAGGGGGATCCGAAGG + Intronic
900323005 1:2094241-2094263 TGCCAAGCCTGGTGACCCGAGGG + Intronic
900532743 1:3162730-3162752 TGCCACACAGGAGGACTGGAGGG - Intronic
902098387 1:13965254-13965276 GTCCAAGCAGGGGGACCTGATGG + Intergenic
911190623 1:94945043-94945065 TGCCACACAGCGGGTCCCAAAGG + Intergenic
913290709 1:117269149-117269171 TGCCTCACAGGGGGACACGACGG + Intergenic
919813896 1:201425919-201425941 TCCCAGGGAGGGGGACCCCATGG - Intronic
922421912 1:225465996-225466018 GGCCACCCAGGAGGACCCCATGG + Intergenic
1069800217 10:71077316-71077338 TGACACCCAGGGGAACCCGATGG + Intergenic
1070919912 10:80178128-80178150 GGCTAGGGAGGGGGACCCGAGGG - Intronic
1079361920 11:19777037-19777059 TGCCACGCGGGGCGGCCCGCGGG + Intronic
1079452602 11:20610246-20610268 TCCCTCGCGGGTGGACCCGAAGG + Intronic
1083064768 11:59913466-59913488 TGCCAGGCAGTGGGAACAGAAGG + Intergenic
1083228558 11:61300351-61300373 TGCCACCCAGGGGGAGGCGTGGG - Intronic
1090102545 11:123815345-123815367 TGCCAAGCAGGGTGACACGGCGG - Intergenic
1096182310 12:49557627-49557649 TGAGACGCTGGGGGACCCCAGGG - Exonic
1096502150 12:52070541-52070563 TGCCACTCGGGGGGACAAGAGGG + Intronic
1103990064 12:124792971-124792993 TGCCACGCGGTGGAACCAGAGGG + Intronic
1104904825 12:132207578-132207600 AGACACGGTGGGGGACCCGAGGG - Intronic
1105291919 13:19058747-19058769 TGCCACGGAGGGGAGCCCGCAGG + Intergenic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1122933027 14:104943414-104943436 TTCCATGCAGGGGGACCTCAAGG - Exonic
1123004283 14:105314171-105314193 ACCCACGCAGGGGGGCGCGAGGG + Exonic
1123783560 15:23647445-23647467 TCCCCCGCTGGGGGGCCCGATGG - Exonic
1130105532 15:80925873-80925895 TGCCTGGCTGGGGGACCAGAAGG - Intronic
1135640739 16:24117885-24117907 TGCAACGGAAGGGGAGCCGACGG - Intronic
1141464122 16:84195554-84195576 GGCCACACAGGGGGGCCCCAAGG + Exonic
1141999354 16:87655254-87655276 GGCCACGCAGGGAGGCCGGAGGG - Intronic
1142323084 16:89397447-89397469 AGCCACACAGGGGGACCCACAGG + Intronic
1143409259 17:6698570-6698592 TGCCATGCAGTGGGAGCCAAAGG + Intronic
1144468079 17:15512878-15512900 TCCCAAGCAGGGGGACTCCATGG - Intronic
1144730335 17:17522333-17522355 GGCCAGGTAGGGGGATCCGAAGG + Exonic
1147359962 17:39924282-39924304 TGCCTCCCAGCGGGATCCGAGGG - Intronic
1147462337 17:40581317-40581339 TGCCACACAGGGCAGCCCGAGGG - Intergenic
1152148678 17:78585127-78585149 GGCCAGGCAGGAGGACCCTATGG - Intergenic
1152193225 17:78901187-78901209 TTCCACGCACGAGGAACCGACGG + Intronic
1153636328 18:7117063-7117085 TCCCGGGCAGGGGGACCCGCAGG - Intronic
1160949096 19:1657239-1657261 TGCCAGGCAGGGGAAGCTGAGGG + Intergenic
1161085872 19:2334635-2334657 TCCCAGGCCGGGGGCCCCGAAGG + Exonic
1166729083 19:45048183-45048205 TGTCAGGCAGGTGGACCCCATGG + Intronic
1166729147 19:45048634-45048656 TGTCAGGCAGGTGGACCCCATGG + Intronic
1167499319 19:49836401-49836423 TGCCAGGTAAGGGGACCCGGGGG + Exonic
1167706083 19:51082094-51082116 TCCCACTCAGTGGGACCCCAAGG + Intronic
925003784 2:426556-426578 TGGCACGCCGGGGGTTCCGATGG + Intergenic
925003808 2:426635-426657 TGGCACGCAGGGGGTTCCGCAGG + Intergenic
925003837 2:426734-426756 TGGCACGCAGGGGGTTCCGCAGG + Intergenic
925003857 2:426794-426816 TGGCACGCAGGGGGTTCCGCTGG + Intergenic
925003882 2:426874-426896 TGGCACGCAGGGGGCTCCGCAGG + Intergenic
925003910 2:426954-426976 TGGCACGCAGGGGGTTCCGCTGG + Intergenic
925003943 2:427054-427076 TGGCACGCAGGGGGTTCCGCAGG + Intergenic
925003956 2:427094-427116 TGGCACGCAGGGGGCTCCGCAGG + Intergenic
925003976 2:427154-427176 TGGCACGCAGGGGGTTCCGCTGG + Intergenic
925004010 2:427255-427277 TGGCACGCAGGGGGTTCCGCAGG + Intergenic
925004023 2:427295-427317 TGGCACGCAGGGGGCTCCGCAGG + Intergenic
925004043 2:427355-427377 TGGCACGCAGGGGGTTCCGCTGG + Intergenic
925004063 2:427415-427437 TGGCACGCAGGGGGCTCCGCAGG + Intergenic
925004088 2:427495-427517 TGGCACGCAGGGGGCTCCGCTGG + Intergenic
925004094 2:427515-427537 TGGCACGCAGGGGGCTCCGCAGG + Intergenic
926139595 2:10360258-10360280 TCCCAGGCAGGGTGAGCCGAAGG + Intronic
926199875 2:10787032-10787054 TGGCACACAGGGCGGCCCGAGGG + Intronic
935187601 2:100748136-100748158 TGCCAGGCAGGGGGAGGAGAGGG + Intergenic
942277315 2:174332813-174332835 AGCCCAGCAGGGGGACCCGGGGG - Intergenic
945314829 2:208360350-208360372 TGCCAGGGAAGGGGCCCCGAGGG - Intronic
945724959 2:213464406-213464428 TGTCACCCAGGGGGACTCAAAGG - Intronic
948392735 2:237624639-237624661 TTCCACGCAGGGAGGGCCGACGG + Intergenic
948397892 2:237661165-237661187 GGCCACGCAGGGAGACCCTGGGG + Intronic
1171346567 20:24470054-24470076 TGCCACCCCGGGAGACGCGAAGG + Intronic
1175291660 20:57879954-57879976 AGCCAAGGAGGGGGACCCCAGGG + Intergenic
1180093586 21:45544202-45544224 TGCCACGCAGGGGGACCCGAGGG - Intronic
1182094187 22:27614989-27615011 TACCAGGCAGGGGGCCCAGAAGG - Intergenic
1184783350 22:46659926-46659948 TGCCACGCTGGGAGATCCCAGGG + Intronic
955350314 3:58188780-58188802 TGCCAGGCAGGGAGACCCCTGGG + Intergenic
959509053 3:107189310-107189332 TGCCAGGTAGGGGGACCCCAAGG + Intergenic
968983657 4:3864191-3864213 TGCCAGGCAGAGGGACCCCTGGG - Intergenic
977101604 4:92822957-92822979 TGCCACTCAGAGAGACCAGAGGG + Intronic
985576698 5:676597-676619 TGCCACACAGGCGGACAGGACGG + Intronic
985925486 5:3012814-3012836 TGCCACGCAGGGCCACAGGAGGG - Intergenic
987379879 5:17275447-17275469 TGCCAAGGAGGAGGCCCCGAAGG + Exonic
998904694 5:146892293-146892315 TGCCACACAGGGGGATCAAAAGG + Intronic
1002158781 5:177303054-177303076 GGCCACGAAGGCGGCCCCGATGG + Exonic
1019929614 7:4214989-4215011 TGCCACCCAGGTGGACCTCATGG + Intronic
1022510819 7:30933819-30933841 TGCCCTGCAGGGGTCCCCGAAGG - Intergenic
1022896111 7:34751718-34751740 AACCAGTCAGGGGGACCCGAAGG - Intronic
1022936747 7:35186246-35186268 GGACACGCAGGGGGACACGCAGG - Intergenic
1029185742 7:98737207-98737229 TCCCTAGCAGGGGGACCTGATGG - Intergenic
1030113997 7:106049523-106049545 TTCCACCCAGGGGAACCCAAAGG - Intergenic
1032840025 7:135706061-135706083 AGCCAGGCAGGAGGACCCCAGGG + Intronic
1037952762 8:23029466-23029488 TGACACGCAGAGGGACCAGGAGG + Intronic
1038019593 8:23541639-23541661 TGCCGGGCAGCGGGACCCGCGGG + Intronic
1038088168 8:24222912-24222934 TGCCACGCATGGGGCCACGTAGG + Intergenic
1043947770 8:86273915-86273937 TGCCATGCAGGGGCACACAAGGG + Intronic
1048877255 8:138846630-138846652 TGCCAAGCAGGTGGACCCTGAGG - Intronic
1049451616 8:142665002-142665024 GGCCCTGCAGGGGGACCGGAGGG + Exonic
1060991945 9:127854436-127854458 GGGCTCGCACGGGGACCCGAGGG + Exonic
1062643049 9:137531489-137531511 TGGCAGGCAGGGGTCCCCGAGGG + Intronic
1186479355 X:9884139-9884161 TTCCAGGCAGGGGGACCAGGTGG + Intronic
1190263596 X:48814872-48814894 TGCCCTGCAAGGGGACCCCAAGG + Exonic
1198729724 X:139716541-139716563 AGCCACACAGTGGGACCCTAAGG - Intergenic