ID: 1180094898

View in Genome Browser
Species Human (GRCh38)
Location 21:45551867-45551889
Sequence GCGCGAACCCCAGTCACGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180094898_1180094905 15 Left 1180094898 21:45551867-45551889 CCCGCCGTGACTGGGGTTCGCGC No data
Right 1180094905 21:45551905-45551927 CGCCTTTATGTCCGTACTTTAGG No data
1180094898_1180094908 24 Left 1180094898 21:45551867-45551889 CCCGCCGTGACTGGGGTTCGCGC No data
Right 1180094908 21:45551914-45551936 GTCCGTACTTTAGGGCAGTGTGG No data
1180094898_1180094906 16 Left 1180094898 21:45551867-45551889 CCCGCCGTGACTGGGGTTCGCGC No data
Right 1180094906 21:45551906-45551928 GCCTTTATGTCCGTACTTTAGGG No data
1180094898_1180094910 30 Left 1180094898 21:45551867-45551889 CCCGCCGTGACTGGGGTTCGCGC No data
Right 1180094910 21:45551920-45551942 ACTTTAGGGCAGTGTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180094898 Original CRISPR GCGCGAACCCCAGTCACGGC GGG (reversed) Intergenic
No off target data available for this crispr