ID: 1180094905

View in Genome Browser
Species Human (GRCh38)
Location 21:45551905-45551927
Sequence CGCCTTTATGTCCGTACTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180094901_1180094905 -7 Left 1180094901 21:45551889-45551911 CCTCCCTGCATGTCCACGCCTTT No data
Right 1180094905 21:45551905-45551927 CGCCTTTATGTCCGTACTTTAGG No data
1180094898_1180094905 15 Left 1180094898 21:45551867-45551889 CCCGCCGTGACTGGGGTTCGCGC No data
Right 1180094905 21:45551905-45551927 CGCCTTTATGTCCGTACTTTAGG No data
1180094900_1180094905 11 Left 1180094900 21:45551871-45551893 CCGTGACTGGGGTTCGCGCCTCC No data
Right 1180094905 21:45551905-45551927 CGCCTTTATGTCCGTACTTTAGG No data
1180094899_1180094905 14 Left 1180094899 21:45551868-45551890 CCGCCGTGACTGGGGTTCGCGCC No data
Right 1180094905 21:45551905-45551927 CGCCTTTATGTCCGTACTTTAGG No data
1180094897_1180094905 16 Left 1180094897 21:45551866-45551888 CCCCGCCGTGACTGGGGTTCGCG No data
Right 1180094905 21:45551905-45551927 CGCCTTTATGTCCGTACTTTAGG No data
1180094902_1180094905 -10 Left 1180094902 21:45551892-45551914 CCCTGCATGTCCACGCCTTTATG No data
Right 1180094905 21:45551905-45551927 CGCCTTTATGTCCGTACTTTAGG No data
1180094893_1180094905 29 Left 1180094893 21:45551853-45551875 CCAGAGTGAAGGGCCCCGCCGTG No data
Right 1180094905 21:45551905-45551927 CGCCTTTATGTCCGTACTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180094905 Original CRISPR CGCCTTTATGTCCGTACTTT AGG Intergenic