ID: 1180094908

View in Genome Browser
Species Human (GRCh38)
Location 21:45551914-45551936
Sequence GTCCGTACTTTAGGGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180094903_1180094908 -2 Left 1180094903 21:45551893-45551915 CCTGCATGTCCACGCCTTTATGT No data
Right 1180094908 21:45551914-45551936 GTCCGTACTTTAGGGCAGTGTGG No data
1180094897_1180094908 25 Left 1180094897 21:45551866-45551888 CCCCGCCGTGACTGGGGTTCGCG No data
Right 1180094908 21:45551914-45551936 GTCCGTACTTTAGGGCAGTGTGG No data
1180094899_1180094908 23 Left 1180094899 21:45551868-45551890 CCGCCGTGACTGGGGTTCGCGCC No data
Right 1180094908 21:45551914-45551936 GTCCGTACTTTAGGGCAGTGTGG No data
1180094898_1180094908 24 Left 1180094898 21:45551867-45551889 CCCGCCGTGACTGGGGTTCGCGC No data
Right 1180094908 21:45551914-45551936 GTCCGTACTTTAGGGCAGTGTGG No data
1180094901_1180094908 2 Left 1180094901 21:45551889-45551911 CCTCCCTGCATGTCCACGCCTTT No data
Right 1180094908 21:45551914-45551936 GTCCGTACTTTAGGGCAGTGTGG No data
1180094902_1180094908 -1 Left 1180094902 21:45551892-45551914 CCCTGCATGTCCACGCCTTTATG No data
Right 1180094908 21:45551914-45551936 GTCCGTACTTTAGGGCAGTGTGG No data
1180094900_1180094908 20 Left 1180094900 21:45551871-45551893 CCGTGACTGGGGTTCGCGCCTCC No data
Right 1180094908 21:45551914-45551936 GTCCGTACTTTAGGGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180094908 Original CRISPR GTCCGTACTTTAGGGCAGTG TGG Intergenic