ID: 1180098710

View in Genome Browser
Species Human (GRCh38)
Location 21:45574385-45574407
Sequence GAGCCGGGCCGGGGTGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180098710_1180098725 10 Left 1180098710 21:45574385-45574407 CCTGCCCCACCCCGGCCCGGCTC No data
Right 1180098725 21:45574418-45574440 TCTGCTCACGTCCAGGGCCTCGG No data
1180098710_1180098731 30 Left 1180098710 21:45574385-45574407 CCTGCCCCACCCCGGCCCGGCTC No data
Right 1180098731 21:45574438-45574460 CGGACTGCCCATGTGTGGGAGGG No data
1180098710_1180098721 4 Left 1180098710 21:45574385-45574407 CCTGCCCCACCCCGGCCCGGCTC No data
Right 1180098721 21:45574412-45574434 GGCCCCTCTGCTCACGTCCAGGG No data
1180098710_1180098727 25 Left 1180098710 21:45574385-45574407 CCTGCCCCACCCCGGCCCGGCTC No data
Right 1180098727 21:45574433-45574455 GGCCTCGGACTGCCCATGTGTGG No data
1180098710_1180098720 3 Left 1180098710 21:45574385-45574407 CCTGCCCCACCCCGGCCCGGCTC No data
Right 1180098720 21:45574411-45574433 CGGCCCCTCTGCTCACGTCCAGG No data
1180098710_1180098730 29 Left 1180098710 21:45574385-45574407 CCTGCCCCACCCCGGCCCGGCTC No data
Right 1180098730 21:45574437-45574459 TCGGACTGCCCATGTGTGGGAGG No data
1180098710_1180098728 26 Left 1180098710 21:45574385-45574407 CCTGCCCCACCCCGGCCCGGCTC No data
Right 1180098728 21:45574434-45574456 GCCTCGGACTGCCCATGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180098710 Original CRISPR GAGCCGGGCCGGGGTGGGGC AGG (reversed) Intergenic