ID: 1180099206

View in Genome Browser
Species Human (GRCh38)
Location 21:45576584-45576606
Sequence ACCTTTCCCTGGCAGGGACC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180099206_1180099222 13 Left 1180099206 21:45576584-45576606 CCCGGTCCCTGCCAGGGAAAGGT No data
Right 1180099222 21:45576620-45576642 CCACCTGGGAAGGACACTGCGGG No data
1180099206_1180099213 -1 Left 1180099206 21:45576584-45576606 CCCGGTCCCTGCCAGGGAAAGGT No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099206_1180099223 14 Left 1180099206 21:45576584-45576606 CCCGGTCCCTGCCAGGGAAAGGT No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099206_1180099220 12 Left 1180099206 21:45576584-45576606 CCCGGTCCCTGCCAGGGAAAGGT No data
Right 1180099220 21:45576619-45576641 ACCACCTGGGAAGGACACTGCGG No data
1180099206_1180099212 -2 Left 1180099206 21:45576584-45576606 CCCGGTCCCTGCCAGGGAAAGGT No data
Right 1180099212 21:45576605-45576627 GTGCGCCCCCCGGAACCACCTGG No data
1180099206_1180099215 3 Left 1180099206 21:45576584-45576606 CCCGGTCCCTGCCAGGGAAAGGT No data
Right 1180099215 21:45576610-45576632 CCCCCCGGAACCACCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180099206 Original CRISPR ACCTTTCCCTGGCAGGGACC GGG (reversed) Intergenic