ID: 1180099207

View in Genome Browser
Species Human (GRCh38)
Location 21:45576585-45576607
Sequence CACCTTTCCCTGGCAGGGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180099207_1180099222 12 Left 1180099207 21:45576585-45576607 CCGGTCCCTGCCAGGGAAAGGTG No data
Right 1180099222 21:45576620-45576642 CCACCTGGGAAGGACACTGCGGG No data
1180099207_1180099223 13 Left 1180099207 21:45576585-45576607 CCGGTCCCTGCCAGGGAAAGGTG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099207_1180099220 11 Left 1180099207 21:45576585-45576607 CCGGTCCCTGCCAGGGAAAGGTG No data
Right 1180099220 21:45576619-45576641 ACCACCTGGGAAGGACACTGCGG No data
1180099207_1180099215 2 Left 1180099207 21:45576585-45576607 CCGGTCCCTGCCAGGGAAAGGTG No data
Right 1180099215 21:45576610-45576632 CCCCCCGGAACCACCTGGGAAGG No data
1180099207_1180099213 -2 Left 1180099207 21:45576585-45576607 CCGGTCCCTGCCAGGGAAAGGTG No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099207_1180099212 -3 Left 1180099207 21:45576585-45576607 CCGGTCCCTGCCAGGGAAAGGTG No data
Right 1180099212 21:45576605-45576627 GTGCGCCCCCCGGAACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180099207 Original CRISPR CACCTTTCCCTGGCAGGGAC CGG (reversed) Intergenic
No off target data available for this crispr