ID: 1180099210

View in Genome Browser
Species Human (GRCh38)
Location 21:45576595-45576617
Sequence CCGGGGGGCGCACCTTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180099210_1180099222 2 Left 1180099210 21:45576595-45576617 CCAGGGAAAGGTGCGCCCCCCGG No data
Right 1180099222 21:45576620-45576642 CCACCTGGGAAGGACACTGCGGG No data
1180099210_1180099220 1 Left 1180099210 21:45576595-45576617 CCAGGGAAAGGTGCGCCCCCCGG No data
Right 1180099220 21:45576619-45576641 ACCACCTGGGAAGGACACTGCGG No data
1180099210_1180099215 -8 Left 1180099210 21:45576595-45576617 CCAGGGAAAGGTGCGCCCCCCGG No data
Right 1180099215 21:45576610-45576632 CCCCCCGGAACCACCTGGGAAGG No data
1180099210_1180099223 3 Left 1180099210 21:45576595-45576617 CCAGGGAAAGGTGCGCCCCCCGG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099210_1180099226 27 Left 1180099210 21:45576595-45576617 CCAGGGAAAGGTGCGCCCCCCGG No data
Right 1180099226 21:45576645-45576667 CTGTGAGCTTGTTCAGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180099210 Original CRISPR CCGGGGGGCGCACCTTTCCC TGG (reversed) Intergenic
No off target data available for this crispr