ID: 1180099213

View in Genome Browser
Species Human (GRCh38)
Location 21:45576606-45576628
Sequence TGCGCCCCCCGGAACCACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180099206_1180099213 -1 Left 1180099206 21:45576584-45576606 CCCGGTCCCTGCCAGGGAAAGGT No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099203_1180099213 1 Left 1180099203 21:45576582-45576604 CCCCCGGTCCCTGCCAGGGAAAG No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099207_1180099213 -2 Left 1180099207 21:45576585-45576607 CCGGTCCCTGCCAGGGAAAGGTG No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099197_1180099213 10 Left 1180099197 21:45576573-45576595 CCCACCCAGCCCCCGGTCCCTGC No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099208_1180099213 -7 Left 1180099208 21:45576590-45576612 CCCTGCCAGGGAAAGGTGCGCCC No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099209_1180099213 -8 Left 1180099209 21:45576591-45576613 CCTGCCAGGGAAAGGTGCGCCCC No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099196_1180099213 11 Left 1180099196 21:45576572-45576594 CCCCACCCAGCCCCCGGTCCCTG No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099199_1180099213 6 Left 1180099199 21:45576577-45576599 CCCAGCCCCCGGTCCCTGCCAGG No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099204_1180099213 0 Left 1180099204 21:45576583-45576605 CCCCGGTCCCTGCCAGGGAAAGG No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099198_1180099213 9 Left 1180099198 21:45576574-45576596 CCACCCAGCCCCCGGTCCCTGCC No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099194_1180099213 18 Left 1180099194 21:45576565-45576587 CCTTCTGCCCCACCCAGCCCCCG No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data
1180099201_1180099213 5 Left 1180099201 21:45576578-45576600 CCAGCCCCCGGTCCCTGCCAGGG No data
Right 1180099213 21:45576606-45576628 TGCGCCCCCCGGAACCACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180099213 Original CRISPR TGCGCCCCCCGGAACCACCT GGG Intergenic
No off target data available for this crispr