ID: 1180099223

View in Genome Browser
Species Human (GRCh38)
Location 21:45576621-45576643
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180099201_1180099223 20 Left 1180099201 21:45576578-45576600 CCAGCCCCCGGTCCCTGCCAGGG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099210_1180099223 3 Left 1180099210 21:45576595-45576617 CCAGGGAAAGGTGCGCCCCCCGG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099196_1180099223 26 Left 1180099196 21:45576572-45576594 CCCCACCCAGCCCCCGGTCCCTG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099203_1180099223 16 Left 1180099203 21:45576582-45576604 CCCCCGGTCCCTGCCAGGGAAAG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099198_1180099223 24 Left 1180099198 21:45576574-45576596 CCACCCAGCCCCCGGTCCCTGCC No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099204_1180099223 15 Left 1180099204 21:45576583-45576605 CCCCGGTCCCTGCCAGGGAAAGG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099207_1180099223 13 Left 1180099207 21:45576585-45576607 CCGGTCCCTGCCAGGGAAAGGTG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099199_1180099223 21 Left 1180099199 21:45576577-45576599 CCCAGCCCCCGGTCCCTGCCAGG No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099208_1180099223 8 Left 1180099208 21:45576590-45576612 CCCTGCCAGGGAAAGGTGCGCCC No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099197_1180099223 25 Left 1180099197 21:45576573-45576595 CCCACCCAGCCCCCGGTCCCTGC No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099209_1180099223 7 Left 1180099209 21:45576591-45576613 CCTGCCAGGGAAAGGTGCGCCCC No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data
1180099206_1180099223 14 Left 1180099206 21:45576584-45576606 CCCGGTCCCTGCCAGGGAAAGGT No data
Right 1180099223 21:45576621-45576643 CACCTGGGAAGGACACTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180099223 Original CRISPR CACCTGGGAAGGACACTGCG GGG Intergenic