ID: 1180099967

View in Genome Browser
Species Human (GRCh38)
Location 21:45579532-45579554
Sequence GCCCTGGGATGCCGGTGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180099962_1180099967 -7 Left 1180099962 21:45579516-45579538 CCCTGGGATGCGGGTGGCCCTGG No data
Right 1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG No data
1180099956_1180099967 9 Left 1180099956 21:45579500-45579522 CCTGGGATGGGGGTGCCCCTGGG No data
Right 1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG No data
1180099953_1180099967 11 Left 1180099953 21:45579498-45579520 CCCCTGGGATGGGGGTGCCCCTG No data
Right 1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG No data
1180099954_1180099967 10 Left 1180099954 21:45579499-45579521 CCCTGGGATGGGGGTGCCCCTGG No data
Right 1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG No data
1180099961_1180099967 -6 Left 1180099961 21:45579515-45579537 CCCCTGGGATGCGGGTGGCCCTG No data
Right 1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG No data
1180099964_1180099967 -8 Left 1180099964 21:45579517-45579539 CCTGGGATGCGGGTGGCCCTGGG No data
Right 1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG No data
1180099947_1180099967 26 Left 1180099947 21:45579483-45579505 CCTGGGATGTGGGTGCCCCTGGG No data
Right 1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG No data
1180099945_1180099967 27 Left 1180099945 21:45579482-45579504 CCCTGGGATGTGGGTGCCCCTGG No data
Right 1180099967 21:45579532-45579554 GCCCTGGGATGCCGGTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180099967 Original CRISPR GCCCTGGGATGCCGGTGCCC TGG Intergenic
No off target data available for this crispr