ID: 1180100246

View in Genome Browser
Species Human (GRCh38)
Location 21:45580578-45580600
Sequence GAGGCAGCTGTGTCTCCGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180100246_1180100251 30 Left 1180100246 21:45580578-45580600 CCTGACGGAGACACAGCTGCCTC No data
Right 1180100251 21:45580631-45580653 TCTCTCCTGCCAAGTGCTGCTGG No data
1180100246_1180100248 -4 Left 1180100246 21:45580578-45580600 CCTGACGGAGACACAGCTGCCTC No data
Right 1180100248 21:45580597-45580619 CCTCTAAAAGCCTCTGAAAGCGG No data
1180100246_1180100249 1 Left 1180100246 21:45580578-45580600 CCTGACGGAGACACAGCTGCCTC No data
Right 1180100249 21:45580602-45580624 AAAAGCCTCTGAAAGCGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180100246 Original CRISPR GAGGCAGCTGTGTCTCCGTC AGG (reversed) Intergenic
No off target data available for this crispr