ID: 1180100373

View in Genome Browser
Species Human (GRCh38)
Location 21:45581192-45581214
Sequence TCTGAAATCCGTCTGGGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180100373_1180100381 20 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100381 21:45581235-45581257 ACTCGCACCCGTGCCCCTCTTGG No data
1180100373_1180100385 27 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100385 21:45581242-45581264 CCCGTGCCCCTCTTGGGAGTGGG No data
1180100373_1180100387 28 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100387 21:45581243-45581265 CCGTGCCCCTCTTGGGAGTGGGG No data
1180100373_1180100379 -5 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100379 21:45581210-45581232 TCAGAATTGCTATGGGCTGGTGG No data
1180100373_1180100382 21 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100382 21:45581236-45581258 CTCGCACCCGTGCCCCTCTTGGG No data
1180100373_1180100383 26 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100383 21:45581241-45581263 ACCCGTGCCCCTCTTGGGAGTGG No data
1180100373_1180100378 -8 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100378 21:45581207-45581229 ATTTCAGAATTGCTATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180100373 Original CRISPR TCTGAAATCCGTCTGGGCGC AGG (reversed) Intergenic
No off target data available for this crispr