ID: 1180100378

View in Genome Browser
Species Human (GRCh38)
Location 21:45581207-45581229
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1180100369_1180100378 14 Left 1180100369 21:45581170-45581192 CCTCCGGGGTGATCACCGGCGGC No data
Right 1180100378 21:45581207-45581229 ATTTCAGAATTGCTATGGGCTGG No data
1180100373_1180100378 -8 Left 1180100373 21:45581192-45581214 CCTGCGCCCAGACGGATTTCAGA No data
Right 1180100378 21:45581207-45581229 ATTTCAGAATTGCTATGGGCTGG No data
1180100370_1180100378 11 Left 1180100370 21:45581173-45581195 CCGGGGTGATCACCGGCGGCCTG No data
Right 1180100378 21:45581207-45581229 ATTTCAGAATTGCTATGGGCTGG No data
1180100366_1180100378 26 Left 1180100366 21:45581158-45581180 CCACTGACTGGGCCTCCGGGGTG No data
Right 1180100378 21:45581207-45581229 ATTTCAGAATTGCTATGGGCTGG No data
1180100372_1180100378 -1 Left 1180100372 21:45581185-45581207 CCGGCGGCCTGCGCCCAGACGGA No data
Right 1180100378 21:45581207-45581229 ATTTCAGAATTGCTATGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1180100378 Original CRISPR ATTTCAGAATTGCTATGGGC TGG Intergenic
No off target data available for this crispr